Gene detail

Detail information of GWHGAAZE013446

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004298347.1	1.43963E-44	PREDICTED: secologanin synthase-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|H2DH17\|C7A22_PANGI	5E-39	Cytochrome P450 CYP749A22
trEMBL	tr\|V4STD1\|V4STD1_9ROSI	3E-44	Uncharacterized protein {ECO:0000313\|EMBL:ESR51108.1}
TAIR10	AT3G14630.1	3E-28	cytochrome P450, family 72, subfamily A, polypeptide 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	102769730	102770047	-
GWHAAZE00000003	mRNA	102769730	102770047	-
GWHAAZE00000003	exon	102769730	102770047	-
GWHAAZE00000003	CDS	102769730	102770047	-

Transcript Sequence
>GWHTAAZE013460 ATGACAAAATTGGGGAAGCTCAATCTTCCAGCCAATGTGGATGTGCTTATTCCACCACTAGCTCTTCAGCATAACCCTGAAATATGGGGGAAAGACGCTCTCCTCTTCAAGCCAGAAAGATTCGCAGAAGCGGTTGCTAAAGCTACCAACAATAACACATTGGCATTTCTTCCATTTGGATTTGGGCCTCTGACTTGCGTGGGATCGAGGTTTGCGAGCACCGAGGCAAAGATGGTACTTTCAATGATTCTTCAACGTTACAAATTTACTCTCTCACCAACTTATGTCCACTCGCCTATTCAGATCCGTACTATTTAG

Network for GWHGAAZE013446

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	3	94	8.00E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15639	CYP734A1, BAS1	Brassinosteroid biosynthesis	map00905

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.126
	SRR3591706	second leaf	3.229
	SRR3591707	mature leaf	5.097
	SRR3591708	Shoot apex	3.703
	SRR3591709	Stem	2.567
	SRR3591710	White floral bud	0.501
	SRR3591711	White flower	0.237
	SRR3591712	Green floral bud	0.528
	SRR3591713	Yellow flower	0.350
SRP173429	SRR8316895	Juvenile bud stage	0.911
	SRR8316896	Juvenile bud stage	1.226
	SRR8316897	Juvenile bud stage	0.132
	SRR8316894	Third green stage	0.322
	SRR8316900	Third green stage	1.935
	SRR8316901	Third green stage	2.148
	SRR8316898	Complete white stage	0.873
	SRR8316899	Complete white stage	6.948
	SRR8316903	Complete white stage	0.549
	SRR8316902	Silver flowering stage	0.690
	SRR8316904	Silver flowering stage	0.768
	SRR8316905	Silver flowering stage	0.689
	SRR8316906	Gold flowering stage	0.648
	SRR8316907	Gold flowering stage	0.833
	SRR8316908	Gold flowering stage	0.185
SRP132670	SRR6706286	Control	2.426
	SRR6706287	Light intensity 50%	2.547
	SRR6706288	Light intensity 20%	3.151
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.800
	CNS0095593	Slightly white alabastrum(diploid) 2	2.098
	CNS0095594	Slightly white alabastrum(diploid) 3	1.627
	CNS0095595	Whole white alabastrum(diploid) 2	2.931
	CNS0095596	Whole white alabastrum(diploid) 3	2.488
	CNS0095597	Whole white alabastrum(diploid) 4	3.586
	CNS0095598	Silvery flower (diploied) 1	4.607
	CNS0095599	Silvery flower (diploied) 2	2.182
	CNS0095600	Silvery flower (diploied) 3	2.594
	CNS0095601	Golden flower (diploid) 1	1.066
	CNS0095602	Golden flower (diploid) 2	1.201
	CNS0095603	Golden flower (diploid) 3	1.278
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.457
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.414
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.190
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.143
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.618
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.593
	CNS0095610	Silvery flower (tetraploid) 1	0.480
	CNS0095611	Silvery flower (tetraploid) 2	0.464
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.473
	CNS0095614	Golden flower (tetraploid) 2	0.694
	CNS0095615	Golden flower (tetraploid) 3	0.531
CRA001975	CRR073297	Stem 1	1.196
	CRR073298	Stem 2	0.648
	CRR073299	Stem 3	0.166
	CRR073300	Leaf 1	0.556
	CRR073301	Leaf 2	0.707
	CRR073302	Leaf 3	1.463
	CRR073303	Juvenile bud 1	0.569
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.252
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.538
	CRR073308	Third green 3	0.802
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.064
	CRR073311	Second white 3	0.168
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.552
	CRR073316	Gold flowering 2	9.785
	CRR073317	Gold flowering 3	1.257
	CRR073318	Tawny withering 1	1.391
	CRR073319	Tawny withering 2	1.371
	CRR073320	Tawny withering 3	0.000