Gene detail

Detail information of GWHGAAZE013506

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002272064.1	9.52841E-87	PREDICTED: psbQ-like protein 1, chloroplastic [Vitis vinifera]
Swissprot	tr\|Q9XI73\|PQL1_ARATH	8E-70	PsbQ-like protein 1, chloroplastic (Precursor)
trEMBL	tr\|D7TN65\|D7TN65_VITVI	4E-87	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI31938.3}
TAIR10	AT1G14150.1	4E-56	PsbQ-like 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	103553552	103554719	+
GWHAAZE00000003	mRNA	103553552	103554719	+
GWHAAZE00000003	exon	103553552	103553998	+
GWHAAZE00000003	exon	103554621	103554719	+
GWHAAZE00000003	CDS	103553552	103553998	+
GWHAAZE00000003	CDS	103554621	103554719	+

Transcript Sequence
>GWHTAAZE013520 ATGTCCTCCACCTCCTTCACTACCTTATTTCACAACACCCGCCACCACCGTCAACTTCCGGTAATCCGGTCATCACTTTCTGGCGAAGAAAATCGAATCGGCCGGAGAAATATTCTGACGACATTTGTGGCCACGTCGATAGCAGCAAATGTGACACCAACAGCATTAGCACAGAATTGGGGTACCCGATCGTTTTTGAAAGAGAGGTTCTTCGAGCCGGGACTATCGACGGAGGATGCTGCGGCCAGAATACGGCAGACGGCGGAGGGACTGCACAGTATAAGGGACATGTTGGAGACGAGGTCGTGGAGGTATGTGATATTTTACATAAGGTTGAAGCAGTCTTATCTTTCTCAGGACATGAAAAATGCTATCACTCTCGTCCCTCAAAACCTACGCAATTCTTATGTTCAAGTTGCCAATGAGTTGGTTGATAACATGGCTGAGTTTGATTACTATGTTCGCACACCAAAGATATACGAATCTTATTTATATTACGAGAAGACTTTGAAGTCAATAGATCAACTTGTGACATTCCTGGCATAG

Network for GWHGAAZE013506

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05757.12	PsbQ	57	181	6.50E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08901	psbQ	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009523	cellular_component	photosystem II
GO:0009654	cellular_component	photosystem II oxygen evolving complex
GO:0019898	cellular_component	extrinsic component of membrane
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.912
	SRR3591706	second leaf	137.887
	SRR3591707	mature leaf	189.258
	SRR3591708	Shoot apex	45.621
	SRR3591709	Stem	18.953
	SRR3591710	White floral bud	2.758
	SRR3591711	White flower	3.958
	SRR3591712	Green floral bud	6.148
	SRR3591713	Yellow flower	0.759
SRP173429	SRR8316895	Juvenile bud stage	22.127
	SRR8316896	Juvenile bud stage	17.450
	SRR8316897	Juvenile bud stage	14.306
	SRR8316894	Third green stage	7.110
	SRR8316900	Third green stage	20.804
	SRR8316901	Third green stage	11.502
	SRR8316898	Complete white stage	1.367
	SRR8316899	Complete white stage	6.673
	SRR8316903	Complete white stage	4.012
	SRR8316902	Silver flowering stage	0.072
	SRR8316904	Silver flowering stage	0.628
	SRR8316905	Silver flowering stage	0.252
	SRR8316906	Gold flowering stage	0.253
	SRR8316907	Gold flowering stage	0.756
	SRR8316908	Gold flowering stage	1.194
SRP132670	SRR6706286	Control	25.156
	SRR6706287	Light intensity 50%	18.743
	SRR6706288	Light intensity 20%	17.943
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.942
	CNS0095593	Slightly white alabastrum(diploid) 2	21.194
	CNS0095594	Slightly white alabastrum(diploid) 3	16.118
	CNS0095595	Whole white alabastrum(diploid) 2	17.493
	CNS0095596	Whole white alabastrum(diploid) 3	14.981
	CNS0095597	Whole white alabastrum(diploid) 4	8.377
	CNS0095598	Silvery flower (diploied) 1	35.036
	CNS0095599	Silvery flower (diploied) 2	32.286
	CNS0095600	Silvery flower (diploied) 3	8.067
	CNS0095601	Golden flower (diploid) 1	31.121
	CNS0095602	Golden flower (diploid) 2	16.395
	CNS0095603	Golden flower (diploid) 3	12.638
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.914
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.326
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.492
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.403
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.038
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.665
	CNS0095610	Silvery flower (tetraploid) 1	5.358
	CNS0095611	Silvery flower (tetraploid) 2	5.923
	CNS0095612	Silvery flower (tetraploid) 3	2.554
	CNS0095613	Golden flower (tetraploid) 1	1.149
	CNS0095614	Golden flower (tetraploid) 2	2.727
	CNS0095615	Golden flower (tetraploid) 3	1.039
CRA001975	CRR073297	Stem 1	56.075
	CRR073298	Stem 2	54.959
	CRR073299	Stem 3	57.140
	CRR073300	Leaf 1	21.386
	CRR073301	Leaf 2	28.699
	CRR073302	Leaf 3	30.397
	CRR073303	Juvenile bud 1	13.702
	CRR073304	Juvenile bud 2	4.293
	CRR073305	Juvenile bud 3	11.856
	CRR073306	Third green 1	1.842
	CRR073307	Third green 2	1.733
	CRR073308	Third green 3	1.840
	CRR073309	Second white 1	0.241
	CRR073310	Second white 2	1.131
	CRR073311	Second white 3	0.331
	CRR073312	Silver flowering 1	0.116
	CRR073313	Silver flowering 2	0.193
	CRR073314	Silver flowering 3	1.577
	CRR073315	Gold flowering 1	367.862
	CRR073316	Gold flowering 2	390.438
	CRR073317	Gold flowering 3	283.996
	CRR073318	Tawny withering 1	25.057
	CRR073319	Tawny withering 2	22.512
	CRR073320	Tawny withering 3	22.245