Gene detail

Detail information of GWHGAAZE013558

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGG09341.1	1.13277E-39	thioredoxin h3 [Vitis vinifera]
Swissprot	tr\|Q38879\|TRXH2_ARATH	8E-35	Thioredoxin H2
trEMBL	tr\|M1R9F8\|M1R9F8_VITVI	4E-40	Thioredoxin {ECO:0000256\|PIRNR:PIRNR000077}
TAIR10	AT5G39950.1	3E-28	thioredoxin 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	104343958	104344533	+
GWHAAZE00000003	mRNA	104343958	104344533	+
GWHAAZE00000003	exon	104343958	104344061	+
GWHAAZE00000003	exon	104344123	104344300	+
GWHAAZE00000003	exon	104344396	104344533	+
GWHAAZE00000003	CDS	104343958	104344061	+
GWHAAZE00000003	CDS	104344123	104344300	+
GWHAAZE00000003	CDS	104344396	104344533	+

Transcript Sequence
>GWHTAAZE013572 ATGGATCTTCATCATCGTCATCAGAGAAGGCTCAAGTTATTTCGTTCCAATCTTCAGATGAATGGAGGACTCATTTTGAAGCCTCCAGAGAAAGTGACACGCTGTTATAAACTAGTTTTTGCCAATATTAATAGTGACAATTTTCTATTTGGAATGAAGATGGTTATCGATTTTTTTGCTTCTTGGTGTGGACCGTGTAAATTGATGGAACCTATCATTCACGAGTTTGCTGCTAAATATACAAATGTTGTGTTCGTTAAGATCGATGTAGATAAGTTGGCGGACGTGGCTCGGGAGTTTGGAATAAAGGCAATGCCAACATTCATACTGATGAAGAAAGGGAAACAAGTCGATCAGCTTATTGGGGCCAAAAAGGAGGAACTCCAGAAGAAGATTGAGAAACACAGGGGGGCCACCTAA

Network for GWHGAAZE013558

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0064

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	53	134	1.30E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	98.935
	SRR3591706	second leaf	133.540
	SRR3591707	mature leaf	698.754
	SRR3591708	Shoot apex	32.191
	SRR3591709	Stem	266.890
	SRR3591710	White floral bud	124.242
	SRR3591711	White flower	88.021
	SRR3591712	Green floral bud	92.476
	SRR3591713	Yellow flower	24.492
SRP173429	SRR8316895	Juvenile bud stage	22.466
	SRR8316896	Juvenile bud stage	23.094
	SRR8316897	Juvenile bud stage	4.772
	SRR8316894	Third green stage	13.680
	SRR8316900	Third green stage	38.380
	SRR8316901	Third green stage	40.135
	SRR8316898	Complete white stage	23.412
	SRR8316899	Complete white stage	141.331
	SRR8316903	Complete white stage	79.623
	SRR8316902	Silver flowering stage	23.288
	SRR8316904	Silver flowering stage	24.818
	SRR8316905	Silver flowering stage	8.926
	SRR8316906	Gold flowering stage	10.355
	SRR8316907	Gold flowering stage	17.267
	SRR8316908	Gold flowering stage	11.330
SRP132670	SRR6706286	Control	78.075
	SRR6706287	Light intensity 50%	66.048
	SRR6706288	Light intensity 20%	50.001
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	100.760
	CNS0095593	Slightly white alabastrum(diploid) 2	129.476
	CNS0095594	Slightly white alabastrum(diploid) 3	87.619
	CNS0095595	Whole white alabastrum(diploid) 2	128.153
	CNS0095596	Whole white alabastrum(diploid) 3	74.995
	CNS0095597	Whole white alabastrum(diploid) 4	102.760
	CNS0095598	Silvery flower (diploied) 1	201.310
	CNS0095599	Silvery flower (diploied) 2	212.577
	CNS0095600	Silvery flower (diploied) 3	52.819
	CNS0095601	Golden flower (diploid) 1	157.796
	CNS0095602	Golden flower (diploid) 2	48.127
	CNS0095603	Golden flower (diploid) 3	47.363
	CNS0095604	Slightly white alabastrum(tetraploid) 1	65.245
	CNS0095605	Slightly white alabastrum(tetraploid) 2	93.211
	CNS0095606	Slightly white alabastrum(tetraploid) 3	81.717
	CNS0095607	Whole white alabastrum(tetraploid) 1	169.392
	CNS0095608	Whole white alabastrum(tetraploid) 2	108.540
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.651
	CNS0095610	Silvery flower (tetraploid) 1	51.080
	CNS0095611	Silvery flower (tetraploid) 2	53.115
	CNS0095612	Silvery flower (tetraploid) 3	17.236
	CNS0095613	Golden flower (tetraploid) 1	70.895
	CNS0095614	Golden flower (tetraploid) 2	36.442
	CNS0095615	Golden flower (tetraploid) 3	26.127
CRA001975	CRR073297	Stem 1	12.779
	CRR073298	Stem 2	15.762
	CRR073299	Stem 3	9.889
	CRR073300	Leaf 1	22.122
	CRR073301	Leaf 2	24.101
	CRR073302	Leaf 3	16.027
	CRR073303	Juvenile bud 1	40.827
	CRR073304	Juvenile bud 2	26.819
	CRR073305	Juvenile bud 3	38.600
	CRR073306	Third green 1	8.857
	CRR073307	Third green 2	13.504
	CRR073308	Third green 3	7.808
	CRR073309	Second white 1	0.695
	CRR073310	Second white 2	2.807
	CRR073311	Second white 3	1.564
	CRR073312	Silver flowering 1	0.262
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	134.039
	CRR073316	Gold flowering 2	110.925
	CRR073317	Gold flowering 3	109.849
	CRR073318	Tawny withering 1	186.552
	CRR073319	Tawny withering 2	458.749
	CRR073320	Tawny withering 3	247.075