Gene detail

Detail information of GWHGAAZE013770

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007039324.1	3.8188E-63	Plastid ribosomal protein l11 [Theobroma cacao]
Swissprot	tr\|Q9MAP3\|RK11_ARATH	2E-63	50S ribosomal protein L11, chloroplastic (Precursor)
trEMBL	tr\|A0A061G1V1\|A0A061G1V1_THECC	1E-63	Plastid ribosomal protein l11 {ECO:0000313\|EMBL:EOY23825.1}
TAIR10	AT1G32990.1	2E-39	plastid ribosomal protein l11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	108047647	108048663	+
GWHAAZE00000003	mRNA	108047647	108048663	+
GWHAAZE00000003	exon	108047647	108047893	+
GWHAAZE00000003	exon	108048057	108048229	+
GWHAAZE00000003	exon	108048577	108048663	+
GWHAAZE00000003	CDS	108047647	108047893	+
GWHAAZE00000003	CDS	108048057	108048229	+
GWHAAZE00000003	CDS	108048577	108048663	+

Transcript Sequence
>GWHTAAZE013784 ATGGCAACAATGGTGTCTCCAATGTCTACGTATCAACCCCTTCCCCCCCATCGTCCTTGTTTGAATAAGAATGGGGCAAAGTTTGCATCCTCTCTTTTACCCAATTTGTCAGTTAACAACTTATCTTCTCTCCATTTCCCTCGCATCATCATCAGTAGGAAGATAACCATACTCCGGACTTCATCTACGAGGTCTCTCACTGTCATTTCCATGGCTCCTCCTAAGCCTGGTGGGAAAGCCAAGAAAGTGACGGGCGTGATAAAGCTGGCCCTAGAGGCAGGGAAGGCTACACCTGCGCCTCCCGTTGGTCCGGCTCTCGGTTCTAAGGGTGTGAACATCATGGCATTCTGCAAGGATTACAATGCCAGGACTGCTGACAAAGCCGGTTATGTCATTCCTGTTGAAATCACCGTTTATGATGACAGAAGCTTCACTTTTATTTTGAAGACACCGCCTGCTTCAGTTCTTCTCCTTAAGGCTGCGGGTATCCTCTTTTCTATCTTTTAA

Network for GWHGAAZE013770

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03946.15	Ribosomal_L11_N	80	144	1.10E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02867	RP-L11, MRPL11, rplK	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	93.063
	SRR3591706	second leaf	212.099
	SRR3591707	mature leaf	99.326
	SRR3591708	Shoot apex	200.652
	SRR3591709	Stem	24.929
	SRR3591710	White floral bud	30.689
	SRR3591711	White flower	18.839
	SRR3591712	Green floral bud	59.956
	SRR3591713	Yellow flower	20.979
SRP173429	SRR8316895	Juvenile bud stage	85.135
	SRR8316896	Juvenile bud stage	94.796
	SRR8316897	Juvenile bud stage	63.965
	SRR8316894	Third green stage	45.106
	SRR8316900	Third green stage	141.170
	SRR8316901	Third green stage	135.661
	SRR8316898	Complete white stage	48.196
	SRR8316899	Complete white stage	104.908
	SRR8316903	Complete white stage	55.137
	SRR8316902	Silver flowering stage	48.663
	SRR8316904	Silver flowering stage	59.541
	SRR8316905	Silver flowering stage	36.270
	SRR8316906	Gold flowering stage	74.260
	SRR8316907	Gold flowering stage	77.526
	SRR8316908	Gold flowering stage	70.437
SRP132670	SRR6706286	Control	181.240
	SRR6706287	Light intensity 50%	170.034
	SRR6706288	Light intensity 20%	191.134
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	71.644
	CNS0095593	Slightly white alabastrum(diploid) 2	56.537
	CNS0095594	Slightly white alabastrum(diploid) 3	49.866
	CNS0095595	Whole white alabastrum(diploid) 2	63.999
	CNS0095596	Whole white alabastrum(diploid) 3	75.907
	CNS0095597	Whole white alabastrum(diploid) 4	50.705
	CNS0095598	Silvery flower (diploied) 1	70.961
	CNS0095599	Silvery flower (diploied) 2	71.679
	CNS0095600	Silvery flower (diploied) 3	68.395
	CNS0095601	Golden flower (diploid) 1	63.606
	CNS0095602	Golden flower (diploid) 2	61.467
	CNS0095603	Golden flower (diploid) 3	60.255
	CNS0095604	Slightly white alabastrum(tetraploid) 1	63.342
	CNS0095605	Slightly white alabastrum(tetraploid) 2	66.721
	CNS0095606	Slightly white alabastrum(tetraploid) 3	93.261
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.029
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.733
	CNS0095609	Whole white alabastrum(tetraploid) 3	88.682
	CNS0095610	Silvery flower (tetraploid) 1	55.194
	CNS0095611	Silvery flower (tetraploid) 2	64.968
	CNS0095612	Silvery flower (tetraploid) 3	66.679
	CNS0095613	Golden flower (tetraploid) 1	26.372
	CNS0095614	Golden flower (tetraploid) 2	42.680
	CNS0095615	Golden flower (tetraploid) 3	38.061
CRA001975	CRR073297	Stem 1	140.627
	CRR073298	Stem 2	123.807
	CRR073299	Stem 3	183.997
	CRR073300	Leaf 1	104.538
	CRR073301	Leaf 2	120.932
	CRR073302	Leaf 3	153.183
	CRR073303	Juvenile bud 1	127.180
	CRR073304	Juvenile bud 2	159.970
	CRR073305	Juvenile bud 3	116.163
	CRR073306	Third green 1	156.862
	CRR073307	Third green 2	101.746
	CRR073308	Third green 3	97.521
	CRR073309	Second white 1	107.630
	CRR073310	Second white 2	63.824
	CRR073311	Second white 3	36.577
	CRR073312	Silver flowering 1	39.017
	CRR073313	Silver flowering 2	68.300
	CRR073314	Silver flowering 3	46.355
	CRR073315	Gold flowering 1	201.678
	CRR073316	Gold flowering 2	238.508
	CRR073317	Gold flowering 3	247.375
	CRR073318	Tawny withering 1	62.537
	CRR073319	Tawny withering 2	64.767
	CRR073320	Tawny withering 3	48.648