Gene detail

Detail information of GWHGAAZE013873

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008221221.1	1.17823E-90	PREDICTED: probable cinnamyl alcohol dehydrogenase 6 [Prunus mume]
Swissprot	tr\|Q7XWU3\|CADH6_ORYSJ	2E-78	Probable cinnamyl alcohol dehydrogenase 6
trEMBL	tr\|M5XP49\|M5XP49_PRUPE	8E-91	Uncharacterized protein {ECO:0000313\|EMBL:EMJ23293.1}
TAIR10	AT4G39330.1	3E-48	cinnamyl alcohol dehydrogenase 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	1874767	1875586	-
GWHAAZE00000004	mRNA	1874767	1875586	-
GWHAAZE00000004	exon	1875492	1875586	-
GWHAAZE00000004	exon	1875131	1875244	-
GWHAAZE00000004	exon	1874767	1875004	-
GWHAAZE00000004	CDS	1875492	1875586	-
GWHAAZE00000004	CDS	1875131	1875244	-
GWHAAZE00000004	CDS	1874767	1875004	-

Transcript Sequence
>GWHTAAZE013887 ATGGCTCAAACAACTCCAAATCACACACAGACTGCTTTCGGCTGGGCAGCTCATGATTCCTCCGGCGTAATTTCCCCCTACACCTTCAAACGAAGAGAAAACGGGGAGAATGACGTGACGATAGAGATATTGTACTGTGGGATGTGTCACACTGATCTCCACTATGCCAGAAACGATTGGGGTATCACCATGTATCCAGTTGTTCCCGGGCATGAAATAGCTGGGGTGATAACCAAGGTGGGAAGTGAGGTGAAAGGGTTCAAGATAGGGGATAGGGTAGGGGTGGGGTGCTTGGCTGCATCATGCTTGAAGTGTGATTACTGTAAGGAATCCCAGGAGAACTACTGTGATCAAGTTCAGTTCAGCTACAATGGCATTTTTTGGGACGGCTCCATCACTTACGGCGGCTACTCCAATTTCTATGTCTCCGATTATCGGTATTTATAA

Network for GWHGAAZE013873

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08240.13	ADH_N	37	143	1.80E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00083	CAD	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008270	molecular_function	zinc ion binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	32.206
	SRR3591706	second leaf	68.319
	SRR3591707	mature leaf	19.054
	SRR3591708	Shoot apex	56.415
	SRR3591709	Stem	6.155
	SRR3591710	White floral bud	11.763
	SRR3591711	White flower	6.306
	SRR3591712	Green floral bud	25.861
	SRR3591713	Yellow flower	0.134
SRP173429	SRR8316895	Juvenile bud stage	25.971
	SRR8316896	Juvenile bud stage	26.119
	SRR8316897	Juvenile bud stage	9.451
	SRR8316894	Third green stage	17.824
	SRR8316900	Third green stage	32.434
	SRR8316901	Third green stage	32.258
	SRR8316898	Complete white stage	0.769
	SRR8316899	Complete white stage	11.029
	SRR8316903	Complete white stage	2.144
	SRR8316902	Silver flowering stage	58.422
	SRR8316904	Silver flowering stage	51.085
	SRR8316905	Silver flowering stage	50.456
	SRR8316906	Gold flowering stage	348.462
	SRR8316907	Gold flowering stage	308.073
	SRR8316908	Gold flowering stage	236.831
SRP132670	SRR6706286	Control	54.452
	SRR6706287	Light intensity 50%	61.083
	SRR6706288	Light intensity 20%	72.686
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.089
	CNS0095593	Slightly white alabastrum(diploid) 2	12.152
	CNS0095594	Slightly white alabastrum(diploid) 3	10.489
	CNS0095595	Whole white alabastrum(diploid) 2	6.927
	CNS0095596	Whole white alabastrum(diploid) 3	2.797
	CNS0095597	Whole white alabastrum(diploid) 4	2.597
	CNS0095598	Silvery flower (diploied) 1	14.669
	CNS0095599	Silvery flower (diploied) 2	7.012
	CNS0095600	Silvery flower (diploied) 3	5.839
	CNS0095601	Golden flower (diploid) 1	6.428
	CNS0095602	Golden flower (diploid) 2	6.278
	CNS0095603	Golden flower (diploid) 3	4.414
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.485
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.294
	CNS0095606	Slightly white alabastrum(tetraploid) 3	56.439
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.440
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.209
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.303
	CNS0095610	Silvery flower (tetraploid) 1	3.472
	CNS0095611	Silvery flower (tetraploid) 2	1.675
	CNS0095612	Silvery flower (tetraploid) 3	0.971
	CNS0095613	Golden flower (tetraploid) 1	3.531
	CNS0095614	Golden flower (tetraploid) 2	2.341
	CNS0095615	Golden flower (tetraploid) 3	1.814
CRA001975	CRR073297	Stem 1	17.030
	CRR073298	Stem 2	23.306
	CRR073299	Stem 3	27.112
	CRR073300	Leaf 1	15.096
	CRR073301	Leaf 2	21.252
	CRR073302	Leaf 3	16.830
	CRR073303	Juvenile bud 1	2.019
	CRR073304	Juvenile bud 2	0.942
	CRR073305	Juvenile bud 3	6.283
	CRR073306	Third green 1	21.061
	CRR073307	Third green 2	7.049
	CRR073308	Third green 3	11.224
	CRR073309	Second white 1	24.094
	CRR073310	Second white 2	36.221
	CRR073311	Second white 3	42.869
	CRR073312	Silver flowering 1	33.756
	CRR073313	Silver flowering 2	20.271
	CRR073314	Silver flowering 3	11.343
	CRR073315	Gold flowering 1	7.579
	CRR073316	Gold flowering 2	4.295
	CRR073317	Gold flowering 3	5.366
	CRR073318	Tawny withering 1	6.285
	CRR073319	Tawny withering 2	7.665
	CRR073320	Tawny withering 3	1.883