Gene detail

Detail information of GWHGAAZE013884

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009766526.1	3.85896E-24	PREDICTED: DNA-directed RNA polymerase I subunit RPA12 [Nicotiana sylvestris]
trEMBL	tr\|S8CSA1\|S8CSA1_9LAMI	2E-23	DNA-directed RNA polymerase subunit {ECO:0000256\|PIRNR:PIRNR005586}
TAIR10	AT3G25940.1	1E-10	TFIIB zinc-binding protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	2162401	2163647	+
GWHAAZE00000004	mRNA	2162401	2163647	+
GWHAAZE00000004	exon	2162401	2162445	+
GWHAAZE00000004	exon	2162909	2162977	+
GWHAAZE00000004	exon	2163075	2163134	+
GWHAAZE00000004	exon	2163452	2163647	+
GWHAAZE00000004	CDS	2162401	2162445	+
GWHAAZE00000004	CDS	2162909	2162977	+
GWHAAZE00000004	CDS	2163075	2163134	+
GWHAAZE00000004	CDS	2163452	2163529	+
GWHAAZE00000004	three_prime_UTR	2163530	2163647	+

Transcript Sequence
>GWHTAAZE013898 ATGGGCCAAACTGCTGAAAGGCTTCAACACGATGTTCGTCCTAGGCATATTAGAAGGGAGCTGGGCATGTCTTCATTAGGTAATAGTGAAGAAGAGAAGGAGAAAAAAGCAATGGATTATAACGCAAGATGTAAGAAATGCAAGAAGATTGGGCTCTACTATACAAGCTTACAGACGAGATCTGCTGATGAAGGACAAACAATCTTTTATGAATGCCCCGGTTGTGGGAACTCTTATAAAGAGAACTCATGAGTCCTTAATACTGTTCAATCTGCTGCATGTCAGAATTGTTGCTGTACCCTGCCTTCATTTTACCCTCCTTGACCCTTTTTTTCTTTATTTGGGGAAAAAAAAGAGAGAAGGAAATTAA

Network for GWHGAAZE013884

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01096.19	TFIIS_C	43	80	1.10E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
K03000	RPA12, ZNRD1	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0006379	biological_process	mRNA cleavage
GO:0003676	molecular_function	nucleic acid binding
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.687
	SRR3591706	second leaf	8.617
	SRR3591707	mature leaf	4.861
	SRR3591708	Shoot apex	24.956
	SRR3591709	Stem	12.645
	SRR3591710	White floral bud	8.655
	SRR3591711	White flower	12.543
	SRR3591712	Green floral bud	23.591
	SRR3591713	Yellow flower	8.841
SRP173429	SRR8316895	Juvenile bud stage	16.853
	SRR8316896	Juvenile bud stage	18.714
	SRR8316897	Juvenile bud stage	6.473
	SRR8316894	Third green stage	7.316
	SRR8316900	Third green stage	21.296
	SRR8316901	Third green stage	19.595
	SRR8316898	Complete white stage	4.078
	SRR8316899	Complete white stage	19.998
	SRR8316903	Complete white stage	4.955
	SRR8316902	Silver flowering stage	4.028
	SRR8316904	Silver flowering stage	4.433
	SRR8316905	Silver flowering stage	1.660
	SRR8316906	Gold flowering stage	7.200
	SRR8316907	Gold flowering stage	7.279
	SRR8316908	Gold flowering stage	6.306
SRP132670	SRR6706286	Control	5.813
	SRR6706287	Light intensity 50%	6.147
	SRR6706288	Light intensity 20%	7.330
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.288
	CNS0095593	Slightly white alabastrum(diploid) 2	29.992
	CNS0095594	Slightly white alabastrum(diploid) 3	18.077
	CNS0095595	Whole white alabastrum(diploid) 2	20.371
	CNS0095596	Whole white alabastrum(diploid) 3	22.328
	CNS0095597	Whole white alabastrum(diploid) 4	15.131
	CNS0095598	Silvery flower (diploied) 1	12.545
	CNS0095599	Silvery flower (diploied) 2	9.392
	CNS0095600	Silvery flower (diploied) 3	6.829
	CNS0095601	Golden flower (diploid) 1	7.551
	CNS0095602	Golden flower (diploid) 2	5.300
	CNS0095603	Golden flower (diploid) 3	5.425
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.985
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.867
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.856
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.489
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.163
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.573
	CNS0095610	Silvery flower (tetraploid) 1	2.795
	CNS0095611	Silvery flower (tetraploid) 2	4.614
	CNS0095612	Silvery flower (tetraploid) 3	5.066
	CNS0095613	Golden flower (tetraploid) 1	1.794
	CNS0095614	Golden flower (tetraploid) 2	2.749
	CNS0095615	Golden flower (tetraploid) 3	1.185
CRA001975	CRR073297	Stem 1	8.859
	CRR073298	Stem 2	7.310
	CRR073299	Stem 3	6.558
	CRR073300	Leaf 1	7.590
	CRR073301	Leaf 2	8.235
	CRR073302	Leaf 3	10.735
	CRR073303	Juvenile bud 1	7.588
	CRR073304	Juvenile bud 2	4.128
	CRR073305	Juvenile bud 3	6.772
	CRR073306	Third green 1	0.651
	CRR073307	Third green 2	0.376
	CRR073308	Third green 3	1.977
	CRR073309	Second white 1	3.613
	CRR073310	Second white 2	1.076
	CRR073311	Second white 3	1.315
	CRR073312	Silver flowering 1	1.074
	CRR073313	Silver flowering 2	0.329
	CRR073314	Silver flowering 3	0.736
	CRR073315	Gold flowering 1	5.266
	CRR073316	Gold flowering 2	7.399
	CRR073317	Gold flowering 3	3.136
	CRR073318	Tawny withering 1	6.857
	CRR073319	Tawny withering 2	9.546
	CRR073320	Tawny withering 3	11.438