Gene detail

Detail information of GWHGAAZE013924

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007223415.1	3.6917E-109	hypothetical protein PRUPE_ppa011277mg [Prunus persica]
Swissprot	tr\|Q96473\|VATL_KALDA	9E-110	V-type proton ATPase 16 kDa proteolipid subunit
trEMBL	tr\|M5XFB5\|M5XFB5_PRUPE	1E-109	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24614.1}
TAIR10	AT1G19910.1	4E-58	ATPase, F0/V0 complex, subunit C protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	2932965	2935913	+
GWHAAZE00000004	mRNA	2932965	2935913	+
GWHAAZE00000004	exon	2932965	2933046	+
GWHAAZE00000004	exon	2933131	2933416	+
GWHAAZE00000004	exon	2935781	2935913	+
GWHAAZE00000004	CDS	2932965	2933046	+
GWHAAZE00000004	CDS	2933131	2933416	+
GWHAAZE00000004	CDS	2935781	2935913	+

Transcript Sequence
>GWHTAAZE013938 ATGTCGTCGTTAACTTTCAGCGGCGATGAAACGGCACCGTTCTTCGGTTTCCTTGGAGCTGCGGCTGCCTTAGTATTCTCGTGTATGGGCGCTGCGTACGGAACCGCAAAGAGTGGAGTGGGAGTGGCGTCAATGGGGGTGATGAGGCCGGAGCTGGTGATGAAGTCGATTGTTCCGGTGGTTATGGCTGGTGTTTTGGGTATTTATGGATTGATTATTGCCGTCATCATCAGTACCGGAATTAACCCTAAGGCCAAGTCTTATTACCTTTTTGATGGTTACGCTCACCTTTCTTCTGGTTTGGCTTGTGGCCTTGCCGGTCTTTCTGCTGGTATGGCTATTGGAATCGTTGGTGATGCCGGTGTTAGAGCTAATGCACAGCAGCCAAAGCTTTTCGTTGGGATGATCCTCATTCTCATTTTTGCTGAAGCGCTAGCTCTCTATGGCCTTATTGTTGGCATCATCCTCTCTTCTCGAGCTGGTCAGTCCAGAGCGGACTAG

Network for GWHGAAZE013924

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	18	77	8.80E-14
PF00137.22	ATP-synt_C	98	156	2.60E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	315.184
	SRR3591706	second leaf	139.930
	SRR3591707	mature leaf	86.076
	SRR3591708	Shoot apex	174.986
	SRR3591709	Stem	202.484
	SRR3591710	White floral bud	160.035
	SRR3591711	White flower	111.342
	SRR3591712	Green floral bud	288.424
	SRR3591713	Yellow flower	101.916
SRP173429	SRR8316895	Juvenile bud stage	153.459
	SRR8316896	Juvenile bud stage	210.651
	SRR8316897	Juvenile bud stage	103.865
	SRR8316894	Third green stage	76.311
	SRR8316900	Third green stage	313.213
	SRR8316901	Third green stage	327.342
	SRR8316898	Complete white stage	134.728
	SRR8316899	Complete white stage	332.360
	SRR8316903	Complete white stage	164.260
	SRR8316902	Silver flowering stage	67.034
	SRR8316904	Silver flowering stage	76.030
	SRR8316905	Silver flowering stage	43.567
	SRR8316906	Gold flowering stage	112.693
	SRR8316907	Gold flowering stage	116.892
	SRR8316908	Gold flowering stage	124.932
SRP132670	SRR6706286	Control	165.906
	SRR6706287	Light intensity 50%	156.241
	SRR6706288	Light intensity 20%	164.989
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	229.212
	CNS0095593	Slightly white alabastrum(diploid) 2	241.354
	CNS0095594	Slightly white alabastrum(diploid) 3	216.600
	CNS0095595	Whole white alabastrum(diploid) 2	285.192
	CNS0095596	Whole white alabastrum(diploid) 3	369.178
	CNS0095597	Whole white alabastrum(diploid) 4	247.788
	CNS0095598	Silvery flower (diploied) 1	121.476
	CNS0095599	Silvery flower (diploied) 2	129.899
	CNS0095600	Silvery flower (diploied) 3	169.500
	CNS0095601	Golden flower (diploid) 1	102.350
	CNS0095602	Golden flower (diploid) 2	153.664
	CNS0095603	Golden flower (diploid) 3	131.982
	CNS0095604	Slightly white alabastrum(tetraploid) 1	334.665
	CNS0095605	Slightly white alabastrum(tetraploid) 2	307.543
	CNS0095606	Slightly white alabastrum(tetraploid) 3	298.124
	CNS0095607	Whole white alabastrum(tetraploid) 1	325.129
	CNS0095608	Whole white alabastrum(tetraploid) 2	318.235
	CNS0095609	Whole white alabastrum(tetraploid) 3	356.742
	CNS0095610	Silvery flower (tetraploid) 1	162.612
	CNS0095611	Silvery flower (tetraploid) 2	166.343
	CNS0095612	Silvery flower (tetraploid) 3	138.667
	CNS0095613	Golden flower (tetraploid) 1	96.505
	CNS0095614	Golden flower (tetraploid) 2	129.277
	CNS0095615	Golden flower (tetraploid) 3	105.339
CRA001975	CRR073297	Stem 1	172.741
	CRR073298	Stem 2	160.157
	CRR073299	Stem 3	206.835
	CRR073300	Leaf 1	233.239
	CRR073301	Leaf 2	220.325
	CRR073302	Leaf 3	314.843
	CRR073303	Juvenile bud 1	301.626
	CRR073304	Juvenile bud 2	305.489
	CRR073305	Juvenile bud 3	258.704
	CRR073306	Third green 1	178.078
	CRR073307	Third green 2	203.339
	CRR073308	Third green 3	152.119
	CRR073309	Second white 1	123.299
	CRR073310	Second white 2	79.183
	CRR073311	Second white 3	59.045
	CRR073312	Silver flowering 1	78.949
	CRR073313	Silver flowering 2	120.231
	CRR073314	Silver flowering 3	84.592
	CRR073315	Gold flowering 1	91.960
	CRR073316	Gold flowering 2	87.062
	CRR073317	Gold flowering 3	121.988
	CRR073318	Tawny withering 1	198.647
	CRR073319	Tawny withering 2	118.852
	CRR073320	Tawny withering 3	191.562