Gene detail

Detail information of GWHGAAZE013946

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011083612.1	1.24736E-65	PREDICTED: probable ubiquitin-conjugating enzyme E2 18 [Sesamum indicum]
Swissprot	tr\|Q9FMM0\|UBC18_ARATH	9E-62	Probable ubiquitin-conjugating enzyme E2 18
trEMBL	tr\|M5XFV3\|M5XFV3_PRUPE	9E-66	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24824.1}
TAIR10	AT1G45050.1	4E-41	Ubiquitin-conjugating enzyme family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	3356520	3357554	+
GWHAAZE00000004	mRNA	3356520	3357554	+
GWHAAZE00000004	exon	3356520	3356549	+
GWHAAZE00000004	exon	3356652	3356755	+
GWHAAZE00000004	exon	3356857	3356959	+
GWHAAZE00000004	exon	3357435	3357554	+
GWHAAZE00000004	CDS	3356520	3356549	+
GWHAAZE00000004	CDS	3356652	3356755	+
GWHAAZE00000004	CDS	3356857	3356959	+
GWHAAZE00000004	CDS	3357435	3357554	+

Transcript Sequence
>GWHTAAZE013960 ATGACCAGTCCCTCCGCTTCTTCTCGCAAGGCTCTGAGCAAGATCGCATGCAATCGGCTTCAGAAGGAACTTGTGGAATGGCAAGTTAATCCCCCATCTGGATTCAAACACAAAGTCACTGACAATCTCCAAAGATGGGTAATTGAAGTTAACGGTGCGCCCGGCACTTTGTATGCTAACGAAACTTACCAGCTTCAAGTTGATTTTCCTGAGAATTACCCTATGGAAGCCCCACAGGTTATTTTTATACCTCCGGCTCCTTTTCATCCTCACATTTATAGCAATGGTCATATTTGTTTAGGTATGCCTATTCTCTATGTTATTGTTAATTATCATTTTGCATCTTTCTCTCAGTAA

Network for GWHGAAZE013946

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	19	101	2.50E-25

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10688	UBE2W, UBC16	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.201
	SRR3591706	second leaf	40.729
	SRR3591707	mature leaf	61.381
	SRR3591708	Shoot apex	36.498
	SRR3591709	Stem	106.640
	SRR3591710	White floral bud	79.104
	SRR3591711	White flower	92.592
	SRR3591712	Green floral bud	81.250
	SRR3591713	Yellow flower	102.439
SRP173429	SRR8316895	Juvenile bud stage	34.464
	SRR8316896	Juvenile bud stage	59.858
	SRR8316897	Juvenile bud stage	26.401
	SRR8316894	Third green stage	21.377
	SRR8316900	Third green stage	69.774
	SRR8316901	Third green stage	76.137
	SRR8316898	Complete white stage	53.375
	SRR8316899	Complete white stage	128.296
	SRR8316903	Complete white stage	73.416
	SRR8316902	Silver flowering stage	71.120
	SRR8316904	Silver flowering stage	80.788
	SRR8316905	Silver flowering stage	42.131
	SRR8316906	Gold flowering stage	176.387
	SRR8316907	Gold flowering stage	190.377
	SRR8316908	Gold flowering stage	152.020
SRP132670	SRR6706286	Control	112.193
	SRR6706287	Light intensity 50%	109.120
	SRR6706288	Light intensity 20%	100.321
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.639
	CNS0095593	Slightly white alabastrum(diploid) 2	56.034
	CNS0095594	Slightly white alabastrum(diploid) 3	58.809
	CNS0095595	Whole white alabastrum(diploid) 2	49.294
	CNS0095596	Whole white alabastrum(diploid) 3	57.736
	CNS0095597	Whole white alabastrum(diploid) 4	46.454
	CNS0095598	Silvery flower (diploied) 1	57.107
	CNS0095599	Silvery flower (diploied) 2	63.124
	CNS0095600	Silvery flower (diploied) 3	134.165
	CNS0095601	Golden flower (diploid) 1	69.611
	CNS0095602	Golden flower (diploid) 2	124.859
	CNS0095603	Golden flower (diploid) 3	111.462
	CNS0095604	Slightly white alabastrum(tetraploid) 1	54.632
	CNS0095605	Slightly white alabastrum(tetraploid) 2	55.106
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.446
	CNS0095607	Whole white alabastrum(tetraploid) 1	59.980
	CNS0095608	Whole white alabastrum(tetraploid) 2	62.905
	CNS0095609	Whole white alabastrum(tetraploid) 3	56.674
	CNS0095610	Silvery flower (tetraploid) 1	114.733
	CNS0095611	Silvery flower (tetraploid) 2	123.946
	CNS0095612	Silvery flower (tetraploid) 3	83.843
	CNS0095613	Golden flower (tetraploid) 1	97.761
	CNS0095614	Golden flower (tetraploid) 2	114.820
	CNS0095615	Golden flower (tetraploid) 3	141.501
CRA001975	CRR073297	Stem 1	45.357
	CRR073298	Stem 2	37.590
	CRR073299	Stem 3	47.141
	CRR073300	Leaf 1	47.145
	CRR073301	Leaf 2	50.726
	CRR073302	Leaf 3	46.585
	CRR073303	Juvenile bud 1	56.389
	CRR073304	Juvenile bud 2	65.749
	CRR073305	Juvenile bud 3	58.785
	CRR073306	Third green 1	55.468
	CRR073307	Third green 2	70.120
	CRR073308	Third green 3	56.527
	CRR073309	Second white 1	98.227
	CRR073310	Second white 2	84.887
	CRR073311	Second white 3	76.368
	CRR073312	Silver flowering 1	54.883
	CRR073313	Silver flowering 2	59.097
	CRR073314	Silver flowering 3	55.049
	CRR073315	Gold flowering 1	38.975
	CRR073316	Gold flowering 2	39.991
	CRR073317	Gold flowering 3	35.976
	CRR073318	Tawny withering 1	68.623
	CRR073319	Tawny withering 2	64.114
	CRR073320	Tawny withering 3	50.910