Gene detail

Detail information of GWHGAAZE013981

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002267044.1	7.70491E-67	PREDICTED: 60S ribosomal protein L6, mitochondrial [Vitis vinifera]
Swissprot	tr\|P26861\|RM06_MARPO	1E-48	60S ribosomal protein L6, mitochondrial
trEMBL	tr\|D7SPD6\|D7SPD6_VITVI	3E-67	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI17515.3}
TAIR10	AT2G18400.1	3E-44	ribosomal protein L6 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	3946591	3946899	+
GWHAAZE00000004	mRNA	3946591	3946899	+
GWHAAZE00000004	exon	3946591	3946899	+
GWHAAZE00000004	CDS	3946591	3946899	+

Transcript Sequence
>GWHTAAZE013995 ATGGAAGCTAAGTTCTTCAGGTTTTTGAAAATTGTAGGAGTTGGGTTTAAAGCAAGGGCCGAATCAGAAGGACGCCTCTTGTACCTGAAATTGGGATACAGCCATGAGGTTGAATTGACGGTACCTCCTGCTGTTCGTGTATTTTGTTTCAAACCAAATATAGTTTGTTGCACAGGGATAGACAAACAAAGAGTCCACCAATTTGCTGCTGCTGTTCGAAGTTGTAAACCTCCCGAAGTTTACAAAGGCAAGGGGATTATGTACATTGACGAAGTTATAAAGAAGAAGCAGGGCAAGAAGTCAAAATAG

Network for GWHGAAZE013981

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00347.24	Ribosomal_L6	13	88	4.10E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02933	RP-L6, MRPL6, rplF	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.057
	SRR3591706	second leaf	2.977
	SRR3591707	mature leaf	5.712
	SRR3591708	Shoot apex	2.301
	SRR3591709	Stem	1.269
	SRR3591710	White floral bud	5.218
	SRR3591711	White flower	9.051
	SRR3591712	Green floral bud	6.854
	SRR3591713	Yellow flower	5.366
SRP173429	SRR8316895	Juvenile bud stage	5.448
	SRR8316896	Juvenile bud stage	8.081
	SRR8316897	Juvenile bud stage	2.506
	SRR8316894	Third green stage	3.776
	SRR8316900	Third green stage	6.719
	SRR8316901	Third green stage	6.034
	SRR8316898	Complete white stage	1.409
	SRR8316899	Complete white stage	3.873
	SRR8316903	Complete white stage	3.798
	SRR8316902	Silver flowering stage	3.499
	SRR8316904	Silver flowering stage	4.577
	SRR8316905	Silver flowering stage	1.637
	SRR8316906	Gold flowering stage	7.126
	SRR8316907	Gold flowering stage	6.356
	SRR8316908	Gold flowering stage	5.266
SRP132670	SRR6706286	Control	8.336
	SRR6706287	Light intensity 50%	10.980
	SRR6706288	Light intensity 20%	7.886
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.204
	CNS0095593	Slightly white alabastrum(diploid) 2	3.850
	CNS0095594	Slightly white alabastrum(diploid) 3	4.840
	CNS0095595	Whole white alabastrum(diploid) 2	2.552
	CNS0095596	Whole white alabastrum(diploid) 3	4.523
	CNS0095597	Whole white alabastrum(diploid) 4	5.369
	CNS0095598	Silvery flower (diploied) 1	4.432
	CNS0095599	Silvery flower (diploied) 2	1.711
	CNS0095600	Silvery flower (diploied) 3	4.672
	CNS0095601	Golden flower (diploid) 1	4.002
	CNS0095602	Golden flower (diploid) 2	6.134
	CNS0095603	Golden flower (diploid) 3	5.367
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.810
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.168
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.286
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.639
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.536
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.512
	CNS0095610	Silvery flower (tetraploid) 1	3.706
	CNS0095611	Silvery flower (tetraploid) 2	2.892
	CNS0095612	Silvery flower (tetraploid) 3	5.939
	CNS0095613	Golden flower (tetraploid) 1	1.965
	CNS0095614	Golden flower (tetraploid) 2	2.765
	CNS0095615	Golden flower (tetraploid) 3	2.797
CRA001975	CRR073297	Stem 1	6.083
	CRR073298	Stem 2	5.673
	CRR073299	Stem 3	1.955
	CRR073300	Leaf 1	5.337
	CRR073301	Leaf 2	6.190
	CRR073302	Leaf 3	1.637
	CRR073303	Juvenile bud 1	4.349
	CRR073304	Juvenile bud 2	1.253
	CRR073305	Juvenile bud 3	2.409
	CRR073306	Third green 1	4.095
	CRR073307	Third green 2	4.899
	CRR073308	Third green 3	4.131
	CRR073309	Second white 1	6.034
	CRR073310	Second white 2	2.792
	CRR073311	Second white 3	3.866
	CRR073312	Silver flowering 1	0.419
	CRR073313	Silver flowering 2	1.518
	CRR073314	Silver flowering 3	0.618
	CRR073315	Gold flowering 1	2.639
	CRR073316	Gold flowering 2	5.516
	CRR073317	Gold flowering 3	3.749
	CRR073318	Tawny withering 1	3.863
	CRR073319	Tawny withering 2	1.965
	CRR073320	Tawny withering 3	0.708