Gene detail

Detail information of GWHGAAZE013994

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011074532.1	1.3346E-99	PREDICTED: deoxyuridine 5'-triphosphate nucleotidohydrolase-like [Sesamum indicum]
Swissprot	tr\|P32518\|DUT_SOLLC	2E-94	Deoxyuridine 5'-triphosphate nucleotidohydrolase
trEMBL	tr\|E0CQ38\|E0CQ38_VITVI	2E-98	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI19684.3}
TAIR10	AT3G46940.1	1E-72	DUTP-PYROPHOSPHATASE-LIKE 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	4150452	4151210	-
GWHAAZE00000004	mRNA	4150452	4151210	-
GWHAAZE00000004	exon	4150452	4150696	-
GWHAAZE00000004	exon	4150807	4150898	-
GWHAAZE00000004	exon	4151002	4151210	-
GWHAAZE00000004	CDS	4151002	4151210	-
GWHAAZE00000004	CDS	4150807	4150898	-
GWHAAZE00000004	CDS	4150452	4150696	-

Transcript Sequence
>GWHTAAZE014008 ATGGCTCAACACGATCCTCAAATCAACAGTCCCGAAATCAAAGAACCAAGCCCAAAGATCCAGAAGCTTGATCAAAACGGTCTTGATCAAAACGGTGCCCACCAAGTGTTCGATCAAATTCCTCCCTTTCTGCGAGTGAAAAAGCTATCAGAGAAAGCTATTTTGCCTTCAAGAGGTTCACTTCTCTCTGCAGGTTACGATCTCTCTAGTGCAACGGAGACTAAAGTACCAGCAAGAGGAAAGGCTTTGATTCCAACAGATCTTAGCATAGCAGTACCTGAAGGAACGTATGCTCGTATTGCGCCGAGATCTGGATTGGCATGGAAGCATTCAATTGATGTAGGGGCCGGAGTAATTGATGCAGACTATAGGGGCCCTGTTGGTGTTATTTTGTTCAATTATTCTGATGTTGACTTTGAAGTAAAGGAGGGTGATAGGATTGCGCAGTTGATTATTGAGAAGATTGTGACACCAGAAGTTACAGAGGTTGATGATTTGGATTCAACTGTGAGGGGCAGTGGTGGTTTTGGTTCAACTGGTGTTTAA

Network for GWHGAAZE013994

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00692.20	dUTPase	52	180	2.20E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01520	dut, DUT	Metabolic pathways	map01100
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983

Gene Ontology

GO term	Ontology	Name
GO:0006226	biological_process	dUMP biosynthetic process
GO:0046081	biological_process	dUTP catabolic process
GO:0000287	molecular_function	magnesium ion binding
GO:0004170	molecular_function	dUTP diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.241
	SRR3591706	second leaf	24.937
	SRR3591707	mature leaf	3.957
	SRR3591708	Shoot apex	212.701
	SRR3591709	Stem	21.278
	SRR3591710	White floral bud	4.403
	SRR3591711	White flower	4.598
	SRR3591712	Green floral bud	6.920
	SRR3591713	Yellow flower	2.127
SRP173429	SRR8316895	Juvenile bud stage	21.045
	SRR8316896	Juvenile bud stage	22.774
	SRR8316897	Juvenile bud stage	13.882
	SRR8316894	Third green stage	4.584
	SRR8316900	Third green stage	9.819
	SRR8316901	Third green stage	5.622
	SRR8316898	Complete white stage	0.762
	SRR8316899	Complete white stage	4.272
	SRR8316903	Complete white stage	1.063
	SRR8316902	Silver flowering stage	1.126
	SRR8316904	Silver flowering stage	1.292
	SRR8316905	Silver flowering stage	0.743
	SRR8316906	Gold flowering stage	1.675
	SRR8316907	Gold flowering stage	0.371
	SRR8316908	Gold flowering stage	1.448
SRP132670	SRR6706286	Control	11.510
	SRR6706287	Light intensity 50%	10.156
	SRR6706288	Light intensity 20%	13.536
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.977
	CNS0095593	Slightly white alabastrum(diploid) 2	21.297
	CNS0095594	Slightly white alabastrum(diploid) 3	18.269
	CNS0095595	Whole white alabastrum(diploid) 2	12.105
	CNS0095596	Whole white alabastrum(diploid) 3	5.986
	CNS0095597	Whole white alabastrum(diploid) 4	7.348
	CNS0095598	Silvery flower (diploied) 1	23.818
	CNS0095599	Silvery flower (diploied) 2	37.975
	CNS0095600	Silvery flower (diploied) 3	11.282
	CNS0095601	Golden flower (diploid) 1	13.079
	CNS0095602	Golden flower (diploid) 2	6.567
	CNS0095603	Golden flower (diploid) 3	5.437
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.068
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.197
	CNS0095606	Slightly white alabastrum(tetraploid) 3	29.346
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.866
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.365
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.691
	CNS0095610	Silvery flower (tetraploid) 1	4.258
	CNS0095611	Silvery flower (tetraploid) 2	3.410
	CNS0095612	Silvery flower (tetraploid) 3	4.547
	CNS0095613	Golden flower (tetraploid) 1	3.349
	CNS0095614	Golden flower (tetraploid) 2	3.317
	CNS0095615	Golden flower (tetraploid) 3	0.941
CRA001975	CRR073297	Stem 1	39.529
	CRR073298	Stem 2	30.883
	CRR073299	Stem 3	64.471
	CRR073300	Leaf 1	4.767
	CRR073301	Leaf 2	5.990
	CRR073302	Leaf 3	7.329
	CRR073303	Juvenile bud 1	10.358
	CRR073304	Juvenile bud 2	4.541
	CRR073305	Juvenile bud 3	7.238
	CRR073306	Third green 1	1.898
	CRR073307	Third green 2	1.795
	CRR073308	Third green 3	1.687
	CRR073309	Second white 1	3.927
	CRR073310	Second white 2	2.370
	CRR073311	Second white 3	3.811
	CRR073312	Silver flowering 1	1.421
	CRR073313	Silver flowering 2	1.899
	CRR073314	Silver flowering 3	2.959
	CRR073315	Gold flowering 1	15.981
	CRR073316	Gold flowering 2	14.101
	CRR073317	Gold flowering 3	13.614
	CRR073318	Tawny withering 1	58.299
	CRR073319	Tawny withering 2	44.928
	CRR073320	Tawny withering 3	86.763