Gene detail

Detail information of GWHGAAZE014060

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011083803.1	4.74273E-91	PREDICTED: transcription factor MYB44-like [Sesamum indicum]
Swissprot	tr\|Q9FDW1\|MYB44_ARATH	4E-52	Transcription factor MYB44
trEMBL	tr\|M5XHQ5\|M5XHQ5_PRUPE	9E-85	Uncharacterized protein {ECO:0000313\|EMBL:EMJ25026.1}
TAIR10	AT4G37260.1	4E-44	myb domain protein 73

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	5016536	5017207	-
GWHAAZE00000004	mRNA	5016536	5017207	-
GWHAAZE00000004	exon	5016536	5017207	-
GWHAAZE00000004	CDS	5016536	5017207	-

Transcript Sequence
>GWHTAAZE014074 ATGGAAGTAATGAACAGGTCTTTCTCACCTGCTACTACTTGTTTGTCCGACTCTTTTTCTTCGGATTTTTCTAAGACACCCTGCAGGCACAAAAACCAATCCGATAGAATAAAAGGTACGTGGAGCGCCGAGGAGGACAATATACTCACCCGATTCGTCCAGCGATACGGGGCCCGAAACTGGTCCCTCATTAGCAAATACATAAAAGGCAGGTCAGGAAAATCTTGCAGGCTCCGGTGGTGTAATCAGCTGTGCCCCAGCGTACAGCACCGCCCCTTCTCCCAATCGGAGGACGAAACTATATTGTCGGCCCACGCCAAGTACGGTAACAGGTGGGCGACTATTGCTAAGTTGCTTACCGGTCGGACTGATAATGCGGTGAAGAACCACTGGAACTCTAGTCTTAAGAATAAGAAGAGGCATCAACAGCAGCGGGAGGAGGAGGGGGATCGATTGGACGGTGGTGTTTTGCTGATTGCTTCGGGATCTGATGACTTTGATCCAATGACAACACTGTCGCTGGCGCCGCCGGGGGTCGGGGGATGTAGGTTTACGGAGAATCGGTCGGAAACTTTGCCGGTGGGAGTTTTGGATGCAATGAGAGATGTGATTGCGAGGGAGGTGAGGGAGTACGTGACGTCGTCGTTTTCTGAGGATTCAACTTTTCGTTAA

Network for GWHGAAZE014060

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13921.7	Myb_DNA-bind_6	41	99	3.10E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	48.870
	SRR3591706	second leaf	0.303
	SRR3591707	mature leaf	0.605
	SRR3591708	Shoot apex	9.370
	SRR3591709	Stem	63.588
	SRR3591710	White floral bud	13.062
	SRR3591711	White flower	11.322
	SRR3591712	Green floral bud	6.288
	SRR3591713	Yellow flower	1.108
SRP173429	SRR8316895	Juvenile bud stage	39.286
	SRR8316896	Juvenile bud stage	26.579
	SRR8316897	Juvenile bud stage	25.052
	SRR8316894	Third green stage	7.277
	SRR8316900	Third green stage	12.655
	SRR8316901	Third green stage	31.610
	SRR8316898	Complete white stage	0.587
	SRR8316899	Complete white stage	107.681
	SRR8316903	Complete white stage	0.521
	SRR8316902	Silver flowering stage	1.498
	SRR8316904	Silver flowering stage	0.081
	SRR8316905	Silver flowering stage	0.104
	SRR8316906	Gold flowering stage	0.119
	SRR8316907	Gold flowering stage	0.167
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	11.007
	SRR6706287	Light intensity 50%	13.875
	SRR6706288	Light intensity 20%	10.656
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.219
	CNS0095593	Slightly white alabastrum(diploid) 2	42.098
	CNS0095594	Slightly white alabastrum(diploid) 3	23.410
	CNS0095595	Whole white alabastrum(diploid) 2	24.025
	CNS0095596	Whole white alabastrum(diploid) 3	4.766
	CNS0095597	Whole white alabastrum(diploid) 4	21.505
	CNS0095598	Silvery flower (diploied) 1	111.160
	CNS0095599	Silvery flower (diploied) 2	146.407
	CNS0095600	Silvery flower (diploied) 3	40.431
	CNS0095601	Golden flower (diploid) 1	133.818
	CNS0095602	Golden flower (diploid) 2	50.028
	CNS0095603	Golden flower (diploid) 3	50.909
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.708
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.992
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.247
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.013
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.129
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.023
	CNS0095610	Silvery flower (tetraploid) 1	0.519
	CNS0095611	Silvery flower (tetraploid) 2	0.492
	CNS0095612	Silvery flower (tetraploid) 3	0.920
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.152
	CNS0095615	Golden flower (tetraploid) 3	0.181
CRA001975	CRR073297	Stem 1	9.122
	CRR073298	Stem 2	6.903
	CRR073299	Stem 3	10.371
	CRR073300	Leaf 1	9.799
	CRR073301	Leaf 2	13.355
	CRR073302	Leaf 3	14.363
	CRR073303	Juvenile bud 1	17.735
	CRR073304	Juvenile bud 2	17.248
	CRR073305	Juvenile bud 3	48.142
	CRR073306	Third green 1	0.341
	CRR073307	Third green 2	0.119
	CRR073308	Third green 3	0.596
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.110
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.812
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	38.478
	CRR073316	Gold flowering 2	91.834
	CRR073317	Gold flowering 3	66.469
	CRR073318	Tawny withering 1	53.699
	CRR073319	Tawny withering 2	131.726
	CRR073320	Tawny withering 3	106.881