Gene detail

Detail information of GWHGAAZE014256

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007018219.1	6.84452E-75	K-box region and MADS-box transcription factor family protein [Theobroma cacao]
Swissprot	tr\|Q9FUY6\|JOIN_SOLLC	4E-54	MADS-box protein JOINTLESS
trEMBL	tr\|A0A061FLR3\|A0A061FLR3_THECC	3E-75	K-box region and MADS-box transcription factor family protein {ECO:0000313\|EMBL:EOY15444.1}
TAIR10	AT2G22540.1	3E-35	K-box region and MADS-box transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	8876083	8882985	-
GWHAAZE00000004	mRNA	8876083	8882985	-
GWHAAZE00000004	exon	8882804	8882985	-
GWHAAZE00000004	exon	8877971	8878070	-
GWHAAZE00000004	exon	8877802	8877843	-
GWHAAZE00000004	exon	8877166	8877207	-
GWHAAZE00000004	exon	8876818	8877014	-
GWHAAZE00000004	exon	8876083	8876107	-
GWHAAZE00000004	CDS	8882804	8882985	-
GWHAAZE00000004	CDS	8877971	8878070	-
GWHAAZE00000004	CDS	8877802	8877843	-
GWHAAZE00000004	CDS	8877166	8877207	-
GWHAAZE00000004	CDS	8876818	8877014	-
GWHAAZE00000004	CDS	8876083	8876107	-

Transcript Sequence
>GWHTAAZE014270 ATGGCTAGAGAGAAGATAAAGATAAGGAAGATCGACAACATAACGGCAAGGCAAGTGACATTTTCCAAGAGAAGAAGAGGGCTTTTGAAGAAAGCTGAGGAACTTGCTGTTCTTTGTGATGCTGAGGTTGCTCTCATCATTTTTTCGGCTACCGGAAAACTATACGAGTATGCCAGCTCAAGGCAGATGAGAGGTGAAGCTCTCGAGGGATTAAACGTGGAGGAACTGCAGCAATTAGAGAAAGTACTTGAGAAAGGGCTAAGCCGTGTGCTTGAAATAAAGGGTGAACGAATTACAAGTGAGATTTCCAGGCTTCAAACGAAGTGTGGTATGTTGGCTGAAGAGAACAAGGCATTGAATCAAAAGATGGTTATGATAGCAAATGGAAAGAGGCCATCAACGGCTGAGATGATGGATAGTAATAGTAATATGATGATGATGATACCCACTGGTACTACTACTACTACTGAAGAACAACCTTCAGAGTCGGCCACCAATGTCTACAGCTGCAACAGTGGCCCACCTCTCGAGGATGATTGTTCCGACACCTCCCTCAAGTTAGCAGGTTTTCCTCCGTTGGGAATGTAA

Network for GWHGAAZE014256

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0261

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00319.19	SRF-TF	10	57	2.60E-24
PF01486.18	K-box	58	123	3.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MADS-MIKC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0045944	biological_process	positive regulation of transcription by RNA polymerase II
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046983	molecular_function	protein dimerization activity
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0000977	molecular_function	RNA polymerase II transcription regulatory region sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	174.541
	SRR3591706	second leaf	26.080
	SRR3591707	mature leaf	26.871
	SRR3591708	Shoot apex	89.553
	SRR3591709	Stem	225.202
	SRR3591710	White floral bud	8.329
	SRR3591711	White flower	4.794
	SRR3591712	Green floral bud	30.424
	SRR3591713	Yellow flower	6.164
SRP173429	SRR8316895	Juvenile bud stage	12.612
	SRR8316896	Juvenile bud stage	39.479
	SRR8316897	Juvenile bud stage	10.919
	SRR8316894	Third green stage	16.030
	SRR8316900	Third green stage	36.063
	SRR8316901	Third green stage	40.494
	SRR8316898	Complete white stage	5.631
	SRR8316899	Complete white stage	39.800
	SRR8316903	Complete white stage	7.406
	SRR8316902	Silver flowering stage	3.438
	SRR8316904	Silver flowering stage	4.476
	SRR8316905	Silver flowering stage	1.438
	SRR8316906	Gold flowering stage	2.514
	SRR8316907	Gold flowering stage	4.732
	SRR8316908	Gold flowering stage	13.972
SRP132670	SRR6706286	Control	15.562
	SRR6706287	Light intensity 50%	13.537
	SRR6706288	Light intensity 20%	13.195
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	39.524
	CNS0095593	Slightly white alabastrum(diploid) 2	38.239
	CNS0095594	Slightly white alabastrum(diploid) 3	45.471
	CNS0095595	Whole white alabastrum(diploid) 2	36.079
	CNS0095596	Whole white alabastrum(diploid) 3	49.409
	CNS0095597	Whole white alabastrum(diploid) 4	42.821
	CNS0095598	Silvery flower (diploied) 1	15.458
	CNS0095599	Silvery flower (diploied) 2	12.648
	CNS0095600	Silvery flower (diploied) 3	13.526
	CNS0095601	Golden flower (diploid) 1	8.137
	CNS0095602	Golden flower (diploid) 2	19.747
	CNS0095603	Golden flower (diploid) 3	19.126
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.845
	CNS0095605	Slightly white alabastrum(tetraploid) 2	26.288
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.658
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.306
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.576
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.649
	CNS0095610	Silvery flower (tetraploid) 1	16.164
	CNS0095611	Silvery flower (tetraploid) 2	14.878
	CNS0095612	Silvery flower (tetraploid) 3	14.890
	CNS0095613	Golden flower (tetraploid) 1	15.228
	CNS0095614	Golden flower (tetraploid) 2	17.499
	CNS0095615	Golden flower (tetraploid) 3	2.251
CRA001975	CRR073297	Stem 1	34.546
	CRR073298	Stem 2	31.617
	CRR073299	Stem 3	32.452
	CRR073300	Leaf 1	22.791
	CRR073301	Leaf 2	25.366
	CRR073302	Leaf 3	29.676
	CRR073303	Juvenile bud 1	19.901
	CRR073304	Juvenile bud 2	13.150
	CRR073305	Juvenile bud 3	12.539
	CRR073306	Third green 1	3.823
	CRR073307	Third green 2	1.476
	CRR073308	Third green 3	2.890
	CRR073309	Second white 1	3.805
	CRR073310	Second white 2	2.152
	CRR073311	Second white 3	1.602
	CRR073312	Silver flowering 1	0.947
	CRR073313	Silver flowering 2	2.707
	CRR073314	Silver flowering 3	1.925
	CRR073315	Gold flowering 1	158.477
	CRR073316	Gold flowering 2	183.137
	CRR073317	Gold flowering 3	123.211
	CRR073318	Tawny withering 1	194.900
	CRR073319	Tawny withering 2	161.093
	CRR073320	Tawny withering 3	170.281