Gene detail

Detail information of GWHGAAZE014323

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABD63905.1	3.04231E-61	14-3-3-like protein [Gossypium hirsutum]
Swissprot	tr\|P93212\|14337_SOLLC	8E-61	14-3-3 protein 7
trEMBL	tr\|F1BWW9\|F1BWW9_GOSHE	1E-61	14-3-3-like protein {ECO:0000313\|EMBL:ADY68780.1}
TAIR10	AT2G42590.2	1E-38	general regulatory factor 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	10188253	10189007	+
GWHAAZE00000004	mRNA	10188253	10189007	+
GWHAAZE00000004	exon	10188253	10188277	+
GWHAAZE00000004	exon	10188367	10188622	+
GWHAAZE00000004	exon	10188738	10188825	+
GWHAAZE00000004	exon	10188909	10189007	+
GWHAAZE00000004	CDS	10188253	10188277	+
GWHAAZE00000004	CDS	10188367	10188622	+
GWHAAZE00000004	CDS	10188738	10188825	+
GWHAAZE00000004	CDS	10188909	10189007	+

Transcript Sequence
>GWHTAAZE014337 ATGCCTTATACTTCTTTTCTTTTTGGAGGGAGTGTCATATTTCATGTTTATGGGTATAAGAATGTGATTGGGTCAAAAGGGGTATCTTGGCATTTATTTTCTTCCAGTGTTGAGAAGGAGGCCGCTAAGGGCCATGAACAAAATTTGAAGAAAATGAAAGATTACAGACATAAGGTTGAGGATGAGCTTACAAGGATATACGACGACGTATTGTTGCTTATTGATGACCACTTGCTTCCATCTTCGTCAACACCAGAATCAATTGTTTTCTTTTATAAAATGAAGGGAGACCACTGTCGTTATTTAGCCAAGACTAAAGTGGGAAATGATCGCAAAGAGGCTACAGATCAGTCACTTAAGGCTTACGAGGCTGGTACTAGTATTGCTACATCAAATCTCCCCCCTACTCATCAAGTTAGACTTGGGCTGGCTTTGAACTTCTCTGTTTTTTTACTACGATGTCCTTAA

Network for GWHGAAZE014323

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00244.21	2014/3/3	18	151	8.20E-44

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06630	YWHAE	MAPK signaling pathway - yeast	map04011
		Hippo signaling pathway	map04390
		Hippo signaling pathway - fly	map04391
		PI3K-Akt signaling pathway	map04151
		Cell cycle	map04110
		Oocyte meiosis	map04114
		NOD-like receptor signaling pathway	map04621
		Neurotrophin signaling pathway	map04722

Gene Ontology

GO term	Ontology	Name
GO:0019904	molecular_function	protein domain specific binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.240
	SRR3591710	White floral bud	13.489
	SRR3591711	White flower	4.744
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	2.404
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	1.784
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	3.228
	SRR8316902	Silver flowering stage	15.552
	SRR8316904	Silver flowering stage	21.579
	SRR8316905	Silver flowering stage	10.878
	SRR8316906	Gold flowering stage	48.520
	SRR8316907	Gold flowering stage	37.377
	SRR8316908	Gold flowering stage	24.886
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.055
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.116
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.114
	CNS0095596	Whole white alabastrum(diploid) 3	0.129
	CNS0095597	Whole white alabastrum(diploid) 4	0.161
	CNS0095598	Silvery flower (diploied) 1	2.791
	CNS0095599	Silvery flower (diploied) 2	5.188
	CNS0095600	Silvery flower (diploied) 3	20.408
	CNS0095601	Golden flower (diploid) 1	4.221
	CNS0095602	Golden flower (diploid) 2	13.018
	CNS0095603	Golden flower (diploid) 3	12.334
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.054
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	16.053
	CNS0095611	Silvery flower (tetraploid) 2	22.685
	CNS0095612	Silvery flower (tetraploid) 3	112.611
	CNS0095613	Golden flower (tetraploid) 1	19.659
	CNS0095614	Golden flower (tetraploid) 2	47.623
	CNS0095615	Golden flower (tetraploid) 3	42.276
CRA001975	CRR073297	Stem 1	0.187
	CRR073298	Stem 2	0.005
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.062
	CRR073306	Third green 1	3.189
	CRR073307	Third green 2	1.596
	CRR073308	Third green 3	0.759
	CRR073309	Second white 1	3.197
	CRR073310	Second white 2	4.748
	CRR073311	Second white 3	2.769
	CRR073312	Silver flowering 1	1.423
	CRR073313	Silver flowering 2	0.617
	CRR073314	Silver flowering 3	0.513
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000