Gene detail

Detail information of GWHGAAZE014390

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010258443.1	8.2634E-136	PREDICTED: vesicle transport v-SNARE 13-like [Nelumbo nucifera]
Swissprot	tr\|Q9LVP9\|VTI13_ARATH	3E-120	Vesicle transport v-SNARE 13
trEMBL	tr\|F6GT59\|F6GT59_VITVI	3E-134	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43068.1}
TAIR10	AT5G39510.1	1E-87	Vesicle transport v-SNARE family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	11348112	11350601	-
GWHAAZE00000004	mRNA	11348112	11350601	-
GWHAAZE00000004	exon	11350508	11350601	-
GWHAAZE00000004	exon	11349244	11349302	-
GWHAAZE00000004	exon	11348972	11349160	-
GWHAAZE00000004	exon	11348397	11348567	-
GWHAAZE00000004	exon	11348112	11348264	-
GWHAAZE00000004	CDS	11350508	11350601	-
GWHAAZE00000004	CDS	11349244	11349302	-
GWHAAZE00000004	CDS	11348972	11349160	-
GWHAAZE00000004	CDS	11348397	11348567	-
GWHAAZE00000004	CDS	11348112	11348264	-

Transcript Sequence
>GWHTAAZE014404 ATGAGTGAGGTATTTGAAGGTTATGAACGCCAATACTGCGAGCTTTCGGCTAATTTGTCCAAAAAATGTACTTCTGCTAGTCTTCTTGACGGAGAGCAAAAGAAGCAAAAGCTTTCTGAAATAAAAGCTGGACTTGATGAAGCAGAAGCTTTGATCCGGAAAATGGACCTTGAGGCTAGAAGTTTGCAACCAAATGTGAAGGCTGTACTCCTTGCTAAGTTAAGGGAATATAAATCTGATCTGAACAATTTGAAGAGTGACGTTAAACGAATTCAATCAACTAACTTAAATCAGGCTGCACGGGATGAGTTGTTGGAATCAGGGATGGCTGATACACAAACTGTGTCAGCGGATCAAAGAACGAGATTATTAATGTCGACTGAAAGATTAAACAAATCGAGTGACAGGGTGAGGGATAGTAGAAAGACCATGCTGGAGACAGAAGATCTTGGTGTTTCAATTCTTCACGATCTCCACCAACAGCGCCAGTCTCTCTTACATGCCCACGGCACGCTCCATGGAGTGGATGACAACATAAGCAAGAGTAAGAAAATCTTGACTGCCATGTCAAGGAGGATGAGCAGGAACAAGTGGATCATCGGCTCCATTGTTTTAGTCCTTATTCTTGCTATCGTCTTGATCTTGTACTTTAAATTGAGGAAATAG

Network for GWHGAAZE014390

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05008.16	V-SNARE	12	90	1.50E-24
PF12352.9	V-SNARE_C	128	193	5.80E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08493	VTI1	SNARE interactions in vesicular transport	map04130
K08493	VTI1	Autophagy - yeast	map04138

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0006886	biological_process	intracellular protein transport
GO:0005794	cellular_component	Golgi apparatus
GO:0016020	cellular_component	membrane
GO:0005484	molecular_function	SNAP receptor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	104.536
	SRR3591706	second leaf	39.900
	SRR3591707	mature leaf	29.135
	SRR3591708	Shoot apex	60.219
	SRR3591709	Stem	99.350
	SRR3591710	White floral bud	85.886
	SRR3591711	White flower	74.641
	SRR3591712	Green floral bud	82.444
	SRR3591713	Yellow flower	59.400
SRP173429	SRR8316895	Juvenile bud stage	39.451
	SRR8316896	Juvenile bud stage	55.146
	SRR8316897	Juvenile bud stage	30.441
	SRR8316894	Third green stage	31.598
	SRR8316900	Third green stage	99.114
	SRR8316901	Third green stage	93.813
	SRR8316898	Complete white stage	68.614
	SRR8316899	Complete white stage	124.296
	SRR8316903	Complete white stage	96.808
	SRR8316902	Silver flowering stage	50.151
	SRR8316904	Silver flowering stage	70.216
	SRR8316905	Silver flowering stage	35.359
	SRR8316906	Gold flowering stage	86.195
	SRR8316907	Gold flowering stage	81.056
	SRR8316908	Gold flowering stage	99.094
SRP132670	SRR6706286	Control	55.818
	SRR6706287	Light intensity 50%	68.049
	SRR6706288	Light intensity 20%	67.551
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	82.537
	CNS0095593	Slightly white alabastrum(diploid) 2	97.365
	CNS0095594	Slightly white alabastrum(diploid) 3	73.394
	CNS0095595	Whole white alabastrum(diploid) 2	84.045
	CNS0095596	Whole white alabastrum(diploid) 3	80.725
	CNS0095597	Whole white alabastrum(diploid) 4	80.051
	CNS0095598	Silvery flower (diploied) 1	72.530
	CNS0095599	Silvery flower (diploied) 2	75.611
	CNS0095600	Silvery flower (diploied) 3	95.493
	CNS0095601	Golden flower (diploid) 1	59.936
	CNS0095602	Golden flower (diploid) 2	67.639
	CNS0095603	Golden flower (diploid) 3	67.706
	CNS0095604	Slightly white alabastrum(tetraploid) 1	84.768
	CNS0095605	Slightly white alabastrum(tetraploid) 2	77.948
	CNS0095606	Slightly white alabastrum(tetraploid) 3	96.089
	CNS0095607	Whole white alabastrum(tetraploid) 1	81.795
	CNS0095608	Whole white alabastrum(tetraploid) 2	68.412
	CNS0095609	Whole white alabastrum(tetraploid) 3	80.587
	CNS0095610	Silvery flower (tetraploid) 1	91.422
	CNS0095611	Silvery flower (tetraploid) 2	86.339
	CNS0095612	Silvery flower (tetraploid) 3	115.773
	CNS0095613	Golden flower (tetraploid) 1	95.841
	CNS0095614	Golden flower (tetraploid) 2	76.723
	CNS0095615	Golden flower (tetraploid) 3	93.344
CRA001975	CRR073297	Stem 1	53.748
	CRR073298	Stem 2	48.248
	CRR073299	Stem 3	56.408
	CRR073300	Leaf 1	58.210
	CRR073301	Leaf 2	57.662
	CRR073302	Leaf 3	73.583
	CRR073303	Juvenile bud 1	86.812
	CRR073304	Juvenile bud 2	79.643
	CRR073305	Juvenile bud 3	92.395
	CRR073306	Third green 1	79.207
	CRR073307	Third green 2	106.511
	CRR073308	Third green 3	84.582
	CRR073309	Second white 1	76.877
	CRR073310	Second white 2	77.171
	CRR073311	Second white 3	52.409
	CRR073312	Silver flowering 1	50.717
	CRR073313	Silver flowering 2	63.283
	CRR073314	Silver flowering 3	62.137
	CRR073315	Gold flowering 1	28.662
	CRR073316	Gold flowering 2	33.045
	CRR073317	Gold flowering 3	29.371
	CRR073318	Tawny withering 1	86.586
	CRR073319	Tawny withering 2	110.958
	CRR073320	Tawny withering 3	102.492