Gene detail

Detail information of GWHGAAZE014401

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU36487.1	3.08569E-35	hypothetical protein MIMGU_mgv1a0227501mg, partial [Erythranthe guttata]
Swissprot	tr\|P21357\|AROF_SOLTU	2E-33	Phospho-2-dehydro-3-deoxyheptonate aldolase 1, chloroplastic (Precursor)
trEMBL	tr\|A0A022R802\|A0A022R802_ERYGU	1E-35	Uncharacterized protein {ECO:0000313\|EMBL:EYU36487.1} (Fragment)
TAIR10	AT4G33510.2	1E-26	3-deoxy-d-arabino-heptulosonate 7-phosphate synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	11501817	11502218	-
GWHAAZE00000004	mRNA	11501817	11502218	-
GWHAAZE00000004	exon	11502048	11502218	-
GWHAAZE00000004	exon	11501817	11502017	-
GWHAAZE00000004	CDS	11502048	11502218	-
GWHAAZE00000004	CDS	11501817	11502017	-

Transcript Sequence
>GWHTAAZE014415 ATGGTGGTGAGAGAGGGGGCAGTTGACAGCTGGAAAACGACAAAGTTACATGATCAACTGCTTGAGTACCCAAACAAGGAGGATTTGGAGTCTGTGCTCCAAATGCTCAATGCATTCCCTCCTCTTGTGATTGCCAGTGGGGCGAGGGATTTGGAGGAACGCCTCGGGGGGGCTGCAACGGGCAATGCCTTTTTGTTGCAAGGCAGAGATTGTGCTGAGAGTTTCAAGGACATCATTGCAAATAATATTGGGGACACTTTTAGGCTTCTCCTCCGGATGGCCTTTGTCCTCACATTCCGCATCACTTTGCCTGACCTTTTTTGTCCAAGTCTCACTCTTCTATATTCTATTATGCTAGCTAGTATTGATTGA

Network for GWHGAAZE014401

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01474.17	DAHP_synth_2	8	104	2.40E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01626	E2.5.1.54, aroF, aroG, aroH	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Phenylalanine, tyrosine and tryptophan biosynthesis	map00400
		Quorum sensing	map02024

Gene Ontology

GO term	Ontology	Name
GO:0009073	biological_process	aromatic amino acid family biosynthetic process
GO:0003849	molecular_function	3-deoxy-7-phosphoheptulonate synthase activity
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.515
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.603
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.431
	SRR8316896	Juvenile bud stage	0.531
	SRR8316897	Juvenile bud stage	0.182
	SRR8316894	Third green stage	0.562
	SRR8316900	Third green stage	1.102
	SRR8316901	Third green stage	0.683
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.149
	SRR8316903	Complete white stage	0.149
	SRR8316902	Silver flowering stage	0.168
	SRR8316904	Silver flowering stage	0.092
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.195
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.385
	SRR6706287	Light intensity 50%	0.649
	SRR6706288	Light intensity 20%	0.576
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.099
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.272
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.241
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.132
	CNS0095601	Golden flower (diploid) 1	0.303
	CNS0095602	Golden flower (diploid) 2	0.115
	CNS0095603	Golden flower (diploid) 3	0.068
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.031
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.549
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.166
	CNS0095610	Silvery flower (tetraploid) 1	0.105
	CNS0095611	Silvery flower (tetraploid) 2	0.078
	CNS0095612	Silvery flower (tetraploid) 3	0.280
	CNS0095613	Golden flower (tetraploid) 1	0.090
	CNS0095614	Golden flower (tetraploid) 2	0.187
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.721
	CRR073298	Stem 2	0.695
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.311
	CRR073301	Leaf 2	0.033
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.211
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.346
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.023
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000