Gene detail

Detail information of GWHGAAZE014425

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004233374.1	4.5505E-162	PREDICTED: UDP-glucose 6-dehydrogenase 1 [Solanum lycopersicum]
Swissprot	tr\|Q9FM01\|UGDH4_ARATH	2E-161	UDP-glucose 6-dehydrogenase 4
trEMBL	tr\|M1CCS3\|M1CCS3_SOLTU	1E-162	UDP-glucose 6-dehydrogenase {ECO:0000256\|PIRNR:PIRNR000124}
TAIR10	AT5G39320.1	4E-130	UDP-glucose 6-dehydrogenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	11730486	11731235	-
GWHAAZE00000004	mRNA	11730486	11731235	-
GWHAAZE00000004	exon	11730486	11731235	-
GWHAAZE00000004	CDS	11730486	11731235	-

Transcript Sequence
>GWHTAAZE014439 ATGTCAGCACTATGTGAGGCCACTGGTGCAAATGTCTCACAAGTGTCATATGCTGTGGGCAAGGATACAAGGATCGGTTCAAGGTTCTTAAATGCTAGTGTTGGTTTTGGCGGGTCTTGCTTTCAAAAGGACATTTTAAACCTTGTTTACATATGTGAGTGCAATGGCCTTCCAGAGGTGGCTGAATATTGGAAACAAGTCATCAAGATTAATGATTACCAAAAGAGCCGCTTTGTAAACCGTATTGTTGCCTCTATGTTCAACACAATTTCAAACAAGAAAATTGCCATCCTAGGATTTGCTTTTAAAAAGGATACAGGTGACACCCGAGAAACTCCAGCAATTGATGTTTGTAAGGGATTGTTGGGAGATAAGGCAATGTTAAGCATATATGATCCACAAGTCACTGAAGAACAGATCCAAAGGGACCTTCGATTAAAGCAATTTGATTGGGACCATCCGATTCATCTACAACCACCAATGACTCCAACCCCTGTGAAACAAGTAAAGGTTGAATGGGATGCTTATATAGCTACAAAGGATTCGCATGCTGTTTGTGTTCTCACAGAGTGGGAAGAATTTAAAACACTTGATTATAAAAAGATTTATGATAGCATGCAAAAGCCTGCATTTTTGTTTGATGGTCGAAATGTTGTGGATGTTGATAAGCTGAGGGAGATTGGTTTCATTGTTTACTCGATTGGTAAGCCACTTGATGCCTGGCTTAAGCACATGCCTGCCGTGGTATAA

Network for GWHGAAZE014425

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00984.20	UDPG_MGDP_dh	1	72	9.80E-20
PF03720.16	UDPG_MGDP_dh_C	96	220	1.00E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00012	UGDH, ugd	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Ascorbate and aldarate metabolism	map00053
		Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016616	molecular_function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
GO:0051287	molecular_function	NAD binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.793
	SRR3591706	second leaf	4.825
	SRR3591707	mature leaf	3.513
	SRR3591708	Shoot apex	4.276
	SRR3591709	Stem	3.251
	SRR3591710	White floral bud	59.777
	SRR3591711	White flower	4.033
	SRR3591712	Green floral bud	238.609
	SRR3591713	Yellow flower	0.999
SRP173429	SRR8316895	Juvenile bud stage	14.354
	SRR8316896	Juvenile bud stage	85.692
	SRR8316897	Juvenile bud stage	61.442
	SRR8316894	Third green stage	44.986
	SRR8316900	Third green stage	226.530
	SRR8316901	Third green stage	230.957
	SRR8316898	Complete white stage	0.270
	SRR8316899	Complete white stage	0.970
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.117
	SRR8316904	Silver flowering stage	1.016
	SRR8316905	Silver flowering stage	0.142
	SRR8316906	Gold flowering stage	0.515
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.535
SRP132670	SRR6706286	Control	18.414
	SRR6706287	Light intensity 50%	19.490
	SRR6706288	Light intensity 20%	18.597
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	74.661
	CNS0095593	Slightly white alabastrum(diploid) 2	46.792
	CNS0095594	Slightly white alabastrum(diploid) 3	87.360
	CNS0095595	Whole white alabastrum(diploid) 2	82.484
	CNS0095596	Whole white alabastrum(diploid) 3	129.067
	CNS0095597	Whole white alabastrum(diploid) 4	67.434
	CNS0095598	Silvery flower (diploied) 1	3.712
	CNS0095599	Silvery flower (diploied) 2	5.423
	CNS0095600	Silvery flower (diploied) 3	1.239
	CNS0095601	Golden flower (diploid) 1	2.402
	CNS0095602	Golden flower (diploid) 2	1.044
	CNS0095603	Golden flower (diploid) 3	1.261
	CNS0095604	Slightly white alabastrum(tetraploid) 1	162.467
	CNS0095605	Slightly white alabastrum(tetraploid) 2	122.868
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.978
	CNS0095607	Whole white alabastrum(tetraploid) 1	185.517
	CNS0095608	Whole white alabastrum(tetraploid) 2	255.258
	CNS0095609	Whole white alabastrum(tetraploid) 3	228.539
	CNS0095610	Silvery flower (tetraploid) 1	0.801
	CNS0095611	Silvery flower (tetraploid) 2	3.834
	CNS0095612	Silvery flower (tetraploid) 3	7.596
	CNS0095613	Golden flower (tetraploid) 1	1.446
	CNS0095614	Golden flower (tetraploid) 2	0.603
	CNS0095615	Golden flower (tetraploid) 3	5.553
CRA001975	CRR073297	Stem 1	13.703
	CRR073298	Stem 2	21.546
	CRR073299	Stem 3	7.913
	CRR073300	Leaf 1	20.090
	CRR073301	Leaf 2	23.172
	CRR073302	Leaf 3	21.743
	CRR073303	Juvenile bud 1	20.809
	CRR073304	Juvenile bud 2	29.369
	CRR073305	Juvenile bud 3	0.937
	CRR073306	Third green 1	5.035
	CRR073307	Third green 2	8.315
	CRR073308	Third green 3	4.532
	CRR073309	Second white 1	0.666
	CRR073310	Second white 2	1.076
	CRR073311	Second white 3	0.738
	CRR073312	Silver flowering 1	6.277
	CRR073313	Silver flowering 2	11.482
	CRR073314	Silver flowering 3	3.105
	CRR073315	Gold flowering 1	6.101
	CRR073316	Gold flowering 2	1.331
	CRR073317	Gold flowering 3	4.582
	CRR073318	Tawny withering 1	4.894
	CRR073319	Tawny withering 2	4.867
	CRR073320	Tawny withering 3	3.519