Gene detail

Detail information of GWHGAAZE014428

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007032712.1	1.72931E-64	F-box protein [Theobroma cacao]
Swissprot	tr\|Q9FL82\|FB270_ARATH	2E-54	F-box protein At5g39250
trEMBL	tr\|A0A061EG72\|A0A061EG72_THECC	6E-65	F-box protein {ECO:0000313\|EMBL:EOY03638.1}
TAIR10	AT5G39250.1	2E-44	F-box family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	11747670	11750416	-
GWHAAZE00000004	mRNA	11747670	11750416	-
GWHAAZE00000004	exon	11750345	11750416	-
GWHAAZE00000004	exon	11747670	11748152	-
GWHAAZE00000004	five_prime_UTR	11750345	11750416	-
GWHAAZE00000004	five_prime_UTR	11748006	11748152	-
GWHAAZE00000004	CDS	11747670	11748005	-

Transcript Sequence
>GWHTAAZE014442 TGGACCGTGCAAGCGAAGATTGCTCTTAGCCTGGGCTTCACCGGATCATCGTTTTCTCTTACAAATTTAAAGATGCATATGTAGAAGTAGCCTCTGAAGGCTGAAGTTGTATGTCTTTCTCAGGTAAGCTCTATGAGCCACCACGTTTGACTCTAATGCTTTAAACAGTTGTGGGAGCGAGTGGATTTTGTTCTTTGCCTACTTTTCTTCCTGCCAAAAATGTCATGCGAAGAGGTTCTGAAGGCCGTCTTTCCACTACTGGAAGGCGCTGACCTTGCTTCTTGTATGGAGGTATGTAAGCAGTGGCGAGATTTAGCCCGAGATGATTACTTTTGGAAATGTCTCTGTGCCAAGAAATGGCCTTCAATCTGCAAGCGCCCATCCCCTCCCACTGTAACGTACTACAAGCTATTCCAAACCTTCTATAAACGTAAGAGCAAACGAACTCTCCTTCCCCCTCGGCTTTCCTTCGCCGATTTGGAGTTTTACATTGACATTTGGACAGAAGAGACCTTAATCTTTTCAGAAGTGGTCCCTGGCCCAGTCCTACAGAAG

Network for GWHGAAZE014428

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12937.8	F-box-like	5	43	3.20E-10

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.955
	SRR3591706	second leaf	20.293
	SRR3591707	mature leaf	20.856
	SRR3591708	Shoot apex	28.640
	SRR3591709	Stem	55.619
	SRR3591710	White floral bud	30.808
	SRR3591711	White flower	34.262
	SRR3591712	Green floral bud	35.508
	SRR3591713	Yellow flower	28.162
SRP173429	SRR8316895	Juvenile bud stage	10.329
	SRR8316896	Juvenile bud stage	17.543
	SRR8316897	Juvenile bud stage	7.957
	SRR8316894	Third green stage	9.271
	SRR8316900	Third green stage	34.137
	SRR8316901	Third green stage	30.144
	SRR8316898	Complete white stage	14.963
	SRR8316899	Complete white stage	32.476
	SRR8316903	Complete white stage	21.355
	SRR8316902	Silver flowering stage	12.905
	SRR8316904	Silver flowering stage	13.950
	SRR8316905	Silver flowering stage	6.867
	SRR8316906	Gold flowering stage	25.924
	SRR8316907	Gold flowering stage	29.990
	SRR8316908	Gold flowering stage	40.445
SRP132670	SRR6706286	Control	31.049
	SRR6706287	Light intensity 50%	30.150
	SRR6706288	Light intensity 20%	29.824
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	29.020
	CNS0095593	Slightly white alabastrum(diploid) 2	21.462
	CNS0095594	Slightly white alabastrum(diploid) 3	19.607
	CNS0095595	Whole white alabastrum(diploid) 2	24.806
	CNS0095596	Whole white alabastrum(diploid) 3	29.407
	CNS0095597	Whole white alabastrum(diploid) 4	27.740
	CNS0095598	Silvery flower (diploied) 1	18.090
	CNS0095599	Silvery flower (diploied) 2	9.004
	CNS0095600	Silvery flower (diploied) 3	29.800
	CNS0095601	Golden flower (diploid) 1	14.546
	CNS0095602	Golden flower (diploid) 2	27.319
	CNS0095603	Golden flower (diploid) 3	29.692
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.775
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.339
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.248
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.630
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.865
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.982
	CNS0095610	Silvery flower (tetraploid) 1	31.002
	CNS0095611	Silvery flower (tetraploid) 2	30.401
	CNS0095612	Silvery flower (tetraploid) 3	42.902
	CNS0095613	Golden flower (tetraploid) 1	23.009
	CNS0095614	Golden flower (tetraploid) 2	23.449
	CNS0095615	Golden flower (tetraploid) 3	47.582
CRA001975	CRR073297	Stem 1	46.279
	CRR073298	Stem 2	37.907
	CRR073299	Stem 3	44.933
	CRR073300	Leaf 1	50.782
	CRR073301	Leaf 2	61.498
	CRR073302	Leaf 3	45.988
	CRR073303	Juvenile bud 1	49.757
	CRR073304	Juvenile bud 2	46.343
	CRR073305	Juvenile bud 3	41.713
	CRR073306	Third green 1	25.668
	CRR073307	Third green 2	28.389
	CRR073308	Third green 3	31.278
	CRR073309	Second white 1	55.130
	CRR073310	Second white 2	43.079
	CRR073311	Second white 3	45.989
	CRR073312	Silver flowering 1	47.728
	CRR073313	Silver flowering 2	50.195
	CRR073314	Silver flowering 3	35.956
	CRR073315	Gold flowering 1	23.805
	CRR073316	Gold flowering 2	27.637
	CRR073317	Gold flowering 3	25.437
	CRR073318	Tawny withering 1	52.538
	CRR073319	Tawny withering 2	31.459
	CRR073320	Tawny withering 3	43.513