Gene detail

Detail information of GWHGAAZE014523

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009616101.1	2.06398E-67	PREDICTED: probable calcium-binding protein CML41 [Nicotiana tomentosiformis]
Swissprot	tr\|Q8L3R2\|CML41_ARATH	6E-59	Probable calcium-binding protein CML41
trEMBL	tr\|B9HEM5\|B9HEM5_POPTR	2E-66	Calmodulin-like gene family protein {ECO:0000313\|EMBL:EEE91229.1}
TAIR10	AT3G50770.1	8E-44	calmodulin-like 41

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	13331957	13332535	+
GWHAAZE00000004	mRNA	13331957	13332535	+
GWHAAZE00000004	exon	13331957	13332535	+
GWHAAZE00000004	CDS	13331957	13332535	+

Transcript Sequence
>GWHTAAZE014537 ATGGAACCTATTAAAGCTCCCAAATCCTTTGGCTGTTTTCCATTTCCTCATAGCTGTCTTAAAATAAACTTACGTCCCAATCGTCCGACCAAATCTACCCCAACTTCGAGCTCATCGAGTTCATTGAAATCAATAGCAACATCAAAGAGTGCTAGCACGATCCAAGACGAGCTTAGAGAAGTGTTTCGTCGTTTTGATGGAGATGGTGATGGGATGATCTCGGCCATTGAACTCAGATCATACTTTGCGTCTATAGGCGAGTACATATCACACGAGGATGCTCAAATTGTTATCGATGATGTGGATACGGATGGAGACAACCTGATAGATTTTGGAGATTTTGTGAAGCTGATGAAAAGGCAGGGTCGTGATGATGATGAGGATCTAAAGGCGGCGTTTGAGATTTTTGAGGTTGAGAAAGGGTCGGGGCGGATAAACCCCAAAAGCTTGCAGAGGGTTTTGGGGCGATTAGGGGATTCGAGAACTTATAATGAGTGTGCTGCCATGATTCAAGTGTTTGATGTGGATGGAAGTGGAGAACTTGATTTCCATGAGTTTCAACAAATGATGGCAGCTTAG

Network for GWHGAAZE014523

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	56	119	1.10E-10
PF00036.33	EF-hand_1	165	191	1.30E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.967
	SRR3591706	second leaf	12.029
	SRR3591707	mature leaf	3.173
	SRR3591708	Shoot apex	2.267
	SRR3591709	Stem	4.142
	SRR3591710	White floral bud	6.864
	SRR3591711	White flower	10.887
	SRR3591712	Green floral bud	6.473
	SRR3591713	Yellow flower	3.923
SRP173429	SRR8316895	Juvenile bud stage	1.897
	SRR8316896	Juvenile bud stage	2.105
	SRR8316897	Juvenile bud stage	1.463
	SRR8316894	Third green stage	1.154
	SRR8316900	Third green stage	3.052
	SRR8316901	Third green stage	2.725
	SRR8316898	Complete white stage	0.766
	SRR8316899	Complete white stage	2.253
	SRR8316903	Complete white stage	1.334
	SRR8316902	Silver flowering stage	0.911
	SRR8316904	Silver flowering stage	2.305
	SRR8316905	Silver flowering stage	1.146
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	1.922
	SRR8316908	Gold flowering stage	2.551
SRP132670	SRR6706286	Control	9.212
	SRR6706287	Light intensity 50%	9.576
	SRR6706288	Light intensity 20%	9.708
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.590
	CNS0095593	Slightly white alabastrum(diploid) 2	5.109
	CNS0095594	Slightly white alabastrum(diploid) 3	5.567
	CNS0095595	Whole white alabastrum(diploid) 2	4.698
	CNS0095596	Whole white alabastrum(diploid) 3	1.047
	CNS0095597	Whole white alabastrum(diploid) 4	3.415
	CNS0095598	Silvery flower (diploied) 1	17.067
	CNS0095599	Silvery flower (diploied) 2	6.720
	CNS0095600	Silvery flower (diploied) 3	5.284
	CNS0095601	Golden flower (diploid) 1	8.957
	CNS0095602	Golden flower (diploid) 2	7.284
	CNS0095603	Golden flower (diploid) 3	8.019
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.682
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.804
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.759
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.383
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.508
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.492
	CNS0095610	Silvery flower (tetraploid) 1	1.342
	CNS0095611	Silvery flower (tetraploid) 2	3.008
	CNS0095612	Silvery flower (tetraploid) 3	0.572
	CNS0095613	Golden flower (tetraploid) 1	2.321
	CNS0095614	Golden flower (tetraploid) 2	0.534
	CNS0095615	Golden flower (tetraploid) 3	0.326
CRA001975	CRR073297	Stem 1	3.626
	CRR073298	Stem 2	3.117
	CRR073299	Stem 3	4.396
	CRR073300	Leaf 1	2.256
	CRR073301	Leaf 2	5.132
	CRR073302	Leaf 3	1.902
	CRR073303	Juvenile bud 1	1.185
	CRR073304	Juvenile bud 2	1.447
	CRR073305	Juvenile bud 3	2.954
	CRR073306	Third green 1	1.038
	CRR073307	Third green 2	0.644
	CRR073308	Third green 3	2.804
	CRR073309	Second white 1	17.625
	CRR073310	Second white 2	4.551
	CRR073311	Second white 3	1.418
	CRR073312	Silver flowering 1	1.365
	CRR073313	Silver flowering 2	14.353
	CRR073314	Silver flowering 3	7.990
	CRR073315	Gold flowering 1	5.138
	CRR073316	Gold flowering 2	6.941
	CRR073317	Gold flowering 3	10.626
	CRR073318	Tawny withering 1	4.927
	CRR073319	Tawny withering 2	9.796
	CRR073320	Tawny withering 3	2.855