Gene detail

Detail information of GWHGAAZE014594

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007047246.1	6.00567E-85	ARM repeat protein interacting with ABF2 isoform 2, partial [Theobroma cacao]
Swissprot	tr\|P41210\|CATR_ATRNU	2E-85	Caltractin
trEMBL	tr\|A0A061DN46\|A0A061DN46_THECC	2E-85	ARM repeat protein interacting with ABF2 isoform 2 {ECO:0000313\|EMBL:EOX91403.1} (Fragment)
TAIR10	AT3G50360.1	1E-63	centrin2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	14882563	14885025	+
GWHAAZE00000004	mRNA	14882563	14885025	+
GWHAAZE00000004	exon	14882563	14882653	+
GWHAAZE00000004	exon	14882738	14882774	+
GWHAAZE00000004	exon	14882866	14882893	+
GWHAAZE00000004	exon	14884661	14884813	+
GWHAAZE00000004	exon	14884885	14885025	+
GWHAAZE00000004	CDS	14882563	14882653	+
GWHAAZE00000004	CDS	14882738	14882774	+
GWHAAZE00000004	CDS	14882866	14882893	+
GWHAAZE00000004	CDS	14884661	14884813	+
GWHAAZE00000004	CDS	14884885	14885025	+

Transcript Sequence
>GWHTAAZE014608 ATGAAGCCCAGAGGACGTCATCATGGGTTAACTCAGCAGAAGAGGCAAGAGATTAAGGAAGCTTTTGAGCTTTTTGATACAGATGGCTCCGGCACCATTGATGCCAAAGAGCTGAATATTGCTATGCGGGCTCTGGGTTTTGAACTGAATGAAGAGCAAATAAATCAAATGATTGCCGATGTGGACAAGGATGGTAGTGGTGCAATTGATTTTGATGAATTTGTGCACATGATGACAGCCAAGATTGGTGAAAGGGACACCAAAGAGGAGCTTATGAAAGCATTCCAAGTCATTGACCAAGATAAAAATGGAAAGATATCTGCTGGAGACATTCAGCGTATTTCGAAGGAGTTAGGCGAACATTTTACCGACAAAGAAATTCAAGAAATGGTTGAGGAAGCAGATCGCGATCGTGAGTTTTCCCTCTCTTTTTTATTGCACGTACTCTAG

Network for GWHGAAZE014594

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	16	78	1.30E-15
PF13499.7	EF-hand_7	89	144	4.20E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	103.149
	SRR3591706	second leaf	71.703
	SRR3591707	mature leaf	63.146
	SRR3591708	Shoot apex	79.592
	SRR3591709	Stem	101.105
	SRR3591710	White floral bud	172.162
	SRR3591711	White flower	205.095
	SRR3591712	Green floral bud	120.467
	SRR3591713	Yellow flower	203.200
SRP173429	SRR8316895	Juvenile bud stage	77.312
	SRR8316896	Juvenile bud stage	126.204
	SRR8316897	Juvenile bud stage	66.787
	SRR8316894	Third green stage	52.114
	SRR8316900	Third green stage	124.521
	SRR8316901	Third green stage	124.048
	SRR8316898	Complete white stage	72.683
	SRR8316899	Complete white stage	139.075
	SRR8316903	Complete white stage	100.242
	SRR8316902	Silver flowering stage	88.905
	SRR8316904	Silver flowering stage	100.242
	SRR8316905	Silver flowering stage	44.555
	SRR8316906	Gold flowering stage	180.944
	SRR8316907	Gold flowering stage	187.192
	SRR8316908	Gold flowering stage	179.443
SRP132670	SRR6706286	Control	116.616
	SRR6706287	Light intensity 50%	141.044
	SRR6706288	Light intensity 20%	137.343
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	142.424
	CNS0095593	Slightly white alabastrum(diploid) 2	141.677
	CNS0095594	Slightly white alabastrum(diploid) 3	139.562
	CNS0095595	Whole white alabastrum(diploid) 2	122.139
	CNS0095596	Whole white alabastrum(diploid) 3	123.683
	CNS0095597	Whole white alabastrum(diploid) 4	105.929
	CNS0095598	Silvery flower (diploied) 1	117.750
	CNS0095599	Silvery flower (diploied) 2	112.005
	CNS0095600	Silvery flower (diploied) 3	130.512
	CNS0095601	Golden flower (diploid) 1	138.604
	CNS0095602	Golden flower (diploid) 2	117.469
	CNS0095603	Golden flower (diploid) 3	111.627
	CNS0095604	Slightly white alabastrum(tetraploid) 1	134.623
	CNS0095605	Slightly white alabastrum(tetraploid) 2	106.089
	CNS0095606	Slightly white alabastrum(tetraploid) 3	142.371
	CNS0095607	Whole white alabastrum(tetraploid) 1	100.661
	CNS0095608	Whole white alabastrum(tetraploid) 2	101.971
	CNS0095609	Whole white alabastrum(tetraploid) 3	129.804
	CNS0095610	Silvery flower (tetraploid) 1	147.170
	CNS0095611	Silvery flower (tetraploid) 2	119.225
	CNS0095612	Silvery flower (tetraploid) 3	113.228
	CNS0095613	Golden flower (tetraploid) 1	124.831
	CNS0095614	Golden flower (tetraploid) 2	122.734
	CNS0095615	Golden flower (tetraploid) 3	112.252
CRA001975	CRR073297	Stem 1	61.493
	CRR073298	Stem 2	65.201
	CRR073299	Stem 3	61.746
	CRR073300	Leaf 1	61.193
	CRR073301	Leaf 2	59.246
	CRR073302	Leaf 3	54.843
	CRR073303	Juvenile bud 1	62.872
	CRR073304	Juvenile bud 2	62.605
	CRR073305	Juvenile bud 3	29.289
	CRR073306	Third green 1	38.728
	CRR073307	Third green 2	38.713
	CRR073308	Third green 3	27.676
	CRR073309	Second white 1	13.125
	CRR073310	Second white 2	39.907
	CRR073311	Second white 3	23.426
	CRR073312	Silver flowering 1	21.335
	CRR073313	Silver flowering 2	10.254
	CRR073314	Silver flowering 3	20.092
	CRR073315	Gold flowering 1	17.419
	CRR073316	Gold flowering 2	34.637
	CRR073317	Gold flowering 3	9.333
	CRR073318	Tawny withering 1	32.750
	CRR073319	Tawny withering 2	36.784
	CRR073320	Tawny withering 3	34.280