Gene detail

Detail information of GWHGAAZE014616

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010315978.1	1.0383E-65	PREDICTED: ethylene-responsive transcription factor ERF011 [Solanum lycopersicum]
Swissprot	tr\|O22174\|ERF08_ARATH	2E-49	Ethylene-responsive transcription factor ERF008
trEMBL	tr\|K4BDA9\|K4BDA9_SOLLC	2E-66	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc02g093130.1.1}
TAIR10	AT2G23340.1	6E-40	DREB and EAR motif protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	15398324	15398707	-
GWHAAZE00000004	mRNA	15398324	15398707	-
GWHAAZE00000004	exon	15398324	15398707	-
GWHAAZE00000004	CDS	15398324	15398707	-

Transcript Sequence
>GWHTAAZE014630 ATGAGAAAGTGGGGTAAATGGGTGGCTGAGATTAGGGAACCGAATAAGCGCTCTAGGATTTGGCTCGGCTCTTACTCTACGCCGGTGGCGGCGGCTAGGGCTTATGATACAGCCGTTTATTACCTCCGGGGGCCGTCGGCTAGGCTCAATTTCCCGGAGTTGCTAGCTGGAGAAGTTGCCGGTGAGCTAAGCGATATGTCGGCCGCTTCTATACGGAAGAAAGCGATAGAGGTTGGGGCGAGAGTTGATGCTCTTCAGGGTTCTCATCAAATCAACGGACACGATCACGCCACGACATCTGAGTTGAAGCCCTGTTGGTTTCAGGAGAAACCCGACTTGAACAAGAAACCCGAACCCGAAGACCCGGATGGCGATTATTGGTGA

Network for GWHGAAZE014616

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	2	44	2.60E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	42.856
	SRR3591706	second leaf	16.322
	SRR3591707	mature leaf	45.954
	SRR3591708	Shoot apex	17.115
	SRR3591709	Stem	50.899
	SRR3591710	White floral bud	90.939
	SRR3591711	White flower	84.064
	SRR3591712	Green floral bud	30.584
	SRR3591713	Yellow flower	82.027
SRP173429	SRR8316895	Juvenile bud stage	8.010
	SRR8316896	Juvenile bud stage	15.488
	SRR8316897	Juvenile bud stage	2.874
	SRR8316894	Third green stage	5.625
	SRR8316900	Third green stage	21.952
	SRR8316901	Third green stage	15.196
	SRR8316898	Complete white stage	44.627
	SRR8316899	Complete white stage	69.877
	SRR8316903	Complete white stage	61.167
	SRR8316902	Silver flowering stage	29.799
	SRR8316904	Silver flowering stage	28.929
	SRR8316905	Silver flowering stage	19.977
	SRR8316906	Gold flowering stage	66.246
	SRR8316907	Gold flowering stage	64.244
	SRR8316908	Gold flowering stage	51.005
SRP132670	SRR6706286	Control	32.648
	SRR6706287	Light intensity 50%	24.686
	SRR6706288	Light intensity 20%	20.270
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.828
	CNS0095593	Slightly white alabastrum(diploid) 2	27.869
	CNS0095594	Slightly white alabastrum(diploid) 3	23.770
	CNS0095595	Whole white alabastrum(diploid) 2	21.157
	CNS0095596	Whole white alabastrum(diploid) 3	19.968
	CNS0095597	Whole white alabastrum(diploid) 4	16.130
	CNS0095598	Silvery flower (diploied) 1	87.095
	CNS0095599	Silvery flower (diploied) 2	60.646
	CNS0095600	Silvery flower (diploied) 3	85.312
	CNS0095601	Golden flower (diploid) 1	93.035
	CNS0095602	Golden flower (diploid) 2	86.541
	CNS0095603	Golden flower (diploid) 3	75.096
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.340
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.264
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.342
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.704
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.344
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.634
	CNS0095610	Silvery flower (tetraploid) 1	78.052
	CNS0095611	Silvery flower (tetraploid) 2	78.602
	CNS0095612	Silvery flower (tetraploid) 3	165.859
	CNS0095613	Golden flower (tetraploid) 1	79.868
	CNS0095614	Golden flower (tetraploid) 2	85.609
	CNS0095615	Golden flower (tetraploid) 3	136.856
CRA001975	CRR073297	Stem 1	47.718
	CRR073298	Stem 2	51.387
	CRR073299	Stem 3	52.154
	CRR073300	Leaf 1	61.692
	CRR073301	Leaf 2	53.135
	CRR073302	Leaf 3	60.744
	CRR073303	Juvenile bud 1	61.351
	CRR073304	Juvenile bud 2	57.297
	CRR073305	Juvenile bud 3	56.430
	CRR073306	Third green 1	56.498
	CRR073307	Third green 2	73.807
	CRR073308	Third green 3	65.863
	CRR073309	Second white 1	34.797
	CRR073310	Second white 2	36.226
	CRR073311	Second white 3	23.842
	CRR073312	Silver flowering 1	28.023
	CRR073313	Silver flowering 2	21.197
	CRR073314	Silver flowering 3	16.931
	CRR073315	Gold flowering 1	41.218
	CRR073316	Gold flowering 2	38.721
	CRR073317	Gold flowering 3	53.407
	CRR073318	Tawny withering 1	79.953
	CRR073319	Tawny withering 2	63.269
	CRR073320	Tawny withering 3	56.022