Gene detail

Detail information of GWHGAAZE014699

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003549991.1	7.03622E-32	PREDICTED: lysosomal Pro-X carboxypeptidase-like [Glycine max]
trEMBL	tr\|I1MVH2\|I1MVH2_SOYBN	3E-32	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA17G16950.1}
TAIR10	AT5G65760.1	1E-13	Serine carboxypeptidase S28 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	16835574	16836508	-
GWHAAZE00000004	mRNA	16835574	16836508	-
GWHAAZE00000004	exon	16836423	16836508	-
GWHAAZE00000004	exon	16835574	16835769	-
GWHAAZE00000004	CDS	16836423	16836508	-
GWHAAZE00000004	CDS	16835574	16835769	-

Transcript Sequence
>GWHTAAZE014713 ATGAAGGATATTAAGGCTGTCTTCAAAATGTTTGGAAGCAACATTATATTCTCAAATGGCCTACTTGATCCTTGGAGTGGTGGAAACAAGGTAGTGCTATTAATTTTTGCAAAAGCAACTTTAATTCTACGTTATTTAACAGGTGCCCATCACATAGATTTGCGTGCAGCAATTGCAGACGATGCTGACTGGTTGGTGCAGCAGAGGGAAACTGAAATAAAGCTGATAAAAGGTTGGTTAAGTGACTACTACCAAAAACAGAAGGCAGTTTTTGACATATAA

Network for GWHGAAZE014699

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05577.13	Peptidase_S28	8	70	1.20E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01285	PRCP	Renin-angiotensin system	map04614
K01285	PRCP	Protein digestion and absorption	map04974

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.495
	SRR3591706	second leaf	0.213
	SRR3591707	mature leaf	0.799
	SRR3591708	Shoot apex	0.946
	SRR3591709	Stem	1.246
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.652
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.318
	SRR8316896	Juvenile bud stage	0.631
	SRR8316897	Juvenile bud stage	1.536
	SRR8316894	Third green stage	0.334
	SRR8316900	Third green stage	1.432
	SRR8316901	Third green stage	0.507
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.610
	SRR8316903	Complete white stage	0.164
	SRR8316902	Silver flowering stage	0.085
	SRR8316904	Silver flowering stage	0.265
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.057
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.209
	SRR6706287	Light intensity 50%	0.213
	SRR6706288	Light intensity 20%	0.956
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.400
	CNS0095593	Slightly white alabastrum(diploid) 2	1.187
	CNS0095594	Slightly white alabastrum(diploid) 3	1.814
	CNS0095595	Whole white alabastrum(diploid) 2	1.086
	CNS0095596	Whole white alabastrum(diploid) 3	2.311
	CNS0095597	Whole white alabastrum(diploid) 4	1.073
	CNS0095598	Silvery flower (diploied) 1	3.194
	CNS0095599	Silvery flower (diploied) 2	0.779
	CNS0095600	Silvery flower (diploied) 3	0.470
	CNS0095601	Golden flower (diploid) 1	1.149
	CNS0095602	Golden flower (diploid) 2	0.721
	CNS0095603	Golden flower (diploid) 3	0.985
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.320
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.423
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.062
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.359
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.005
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.753
	CNS0095610	Silvery flower (tetraploid) 1	1.216
	CNS0095611	Silvery flower (tetraploid) 2	1.771
	CNS0095612	Silvery flower (tetraploid) 3	0.087
	CNS0095613	Golden flower (tetraploid) 1	0.130
	CNS0095614	Golden flower (tetraploid) 2	1.027
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.860
	CRR073298	Stem 2	0.341
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.396
	CRR073301	Leaf 2	0.616
	CRR073302	Leaf 3	0.194
	CRR073303	Juvenile bud 1	0.237
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.144
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.480
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.788