Gene detail

Detail information of GWHGAAZE014846

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010649139.1	1.25556E-96	PREDICTED: GATA transcription factor 18-like [Vitis vinifera]
Swissprot	tr\|Q8LC79\|GAT18_ARATH	1E-49	GATA transcription factor 18
trEMBL	tr\|A5C2I6\|A5C2I6_VITVI	9E-96	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN72981.1}
TAIR10	AT3G50870.1	2E-37	GATA type zinc finger transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	20200423	20201804	+
GWHAAZE00000004	mRNA	20200423	20201804	+
GWHAAZE00000004	exon	20200423	20200887	+
GWHAAZE00000004	exon	20201175	20201429	+
GWHAAZE00000004	exon	20201763	20201804	+
GWHAAZE00000004	five_prime_UTR	20200423	20200452	+
GWHAAZE00000004	CDS	20200453	20200887	+
GWHAAZE00000004	CDS	20201175	20201429	+
GWHAAZE00000004	CDS	20201763	20201804	+

Transcript Sequence
>GWHTAAZE014860 GATCTCTGTTCAAGATTACATCTAAGAGAAATGCATAGGTGTAGTAGCGCCCACGGTAACGTGGTGGGGGGTCCGTGTTCGTGCGGGTACTTCCACAACCAGAGCAATTCCTTCTCAATGCTGTTCGCTATGCCGAATCACAAGGGGCCGTTCGATGAGTCCGATTATTGCCCTTACGCCTCTCCTTCTTCGTCCGTTGATTGTACTCTCTCTCTTGGAACACCTTCCACTCGTCTGTCAAATGACAGTGAAAAAGCAGTTCATCATGAACGCCGCTCTAATAATTCTTATATGCCTAACTTTTGTTGGGATATATTACAGTCCAAATCTTCACCAGCCGGTAACAAGCCCGGACGCGGTAGTGGTAGCAACAACTCCTGCCCAGACCCGCTCCTTGCACGTCGTTGTGCCAACTGCGACACCACTTCTACACCACTCTGGCGCAATGGGCCCCGAGGCCCCAAGTCACTTTGCAATGCGTGTGGGATTCGGTTCAAGAAAGAAGAGAGGAGAGCGACGGCGGCAGCCTCCACATCAGCTGCCAATTCCGGCGGTGCACCACCGGCAATCATGGAATCTCAGCACATGATGTGGGGCCAGCACACACAGGCACAGAAAATGCAGTGCTTGTCTCCGCCATTCGGGAACGAGTACAGGTTCATTGAGGATGATGATCGTGACTCGGACAGTGGCATTCCCTTCCTCTCGTGGCGTCTCAATGGCACCCCGCCCCCTTCTATATCTGCTTTATTTCAATTTTAA

Network for GWHGAAZE014846

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00320.28	GATA	126	160	5.80E-18

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-GATA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0008270	molecular_function	zinc ion binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.245
	SRR3591706	second leaf	0.273
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	5.512
	SRR3591709	Stem	1.576
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.098
	SRR3591712	Green floral bud	0.415
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.799
	SRR8316896	Juvenile bud stage	0.735
	SRR8316897	Juvenile bud stage	0.723
	SRR8316894	Third green stage	0.475
	SRR8316900	Third green stage	0.116
	SRR8316901	Third green stage	0.164
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.405
	SRR8316903	Complete white stage	0.269
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.190
	SRR6706287	Light intensity 50%	0.076
	SRR6706288	Light intensity 20%	0.152
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.967
	CNS0095593	Slightly white alabastrum(diploid) 2	1.966
	CNS0095594	Slightly white alabastrum(diploid) 3	1.185
	CNS0095595	Whole white alabastrum(diploid) 2	0.274
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.196
	CNS0095598	Silvery flower (diploied) 1	0.841
	CNS0095599	Silvery flower (diploied) 2	0.291
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.075
	CNS0095603	Golden flower (diploid) 3	0.244
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.995
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.786
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.335
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.470
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.095
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.129
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.259
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.993
	CRR073298	Stem 2	2.480
	CRR073299	Stem 3	4.818
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.076
	CRR073302	Leaf 3	0.711
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.213
	CRR073306	Third green 1	0.001
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.230
	CRR073316	Gold flowering 2	0.185
	CRR073317	Gold flowering 3	0.194
	CRR073318	Tawny withering 1	1.543
	CRR073319	Tawny withering 2	1.131
	CRR073320	Tawny withering 3	2.328