Gene detail

Detail information of GWHGAAZE014890

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010254700.1	4.67377E-49	PREDICTED: 54S ribosomal protein L12, mitochondrial [Nelumbo nucifera]
Swissprot	tr\|Q1ACG9\|RK12_CHAVU	2E-13	50S ribosomal protein L12, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00368}
trEMBL	tr\|A0A022QUA5\|A0A022QUA5_ERYGU	3E-46	Uncharacterized protein {ECO:0000313\|EMBL:EYU31174.1}
TAIR10	AT4G36420.1	4E-21	Ribosomal protein L12 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	20986438	20986803	+
GWHAAZE00000004	mRNA	20986438	20986803	+
GWHAAZE00000004	exon	20986438	20986803	+
GWHAAZE00000004	CDS	20986438	20986803	+

Transcript Sequence
>GWHTAAZE014904 ATGGCCGATTTGGTCGAGCTTTTGAGGAAGAAATTGGACATAAAGGAGATGCCCGCCATGGCATTTATGATGCCCGGCATGGGGTTCGGCGGTGTTAAGAGCGGAGCCAAGGGCGCCGGACCTGCTAAGGAGGAGGTGAAGAAGGAGAAGACGGCGTTCGATTTGAAGCTCGAGGGAGGGTTCGATGCGTCGGTGAAGATTAAGATTATTAAGGAAGTTCGGGCTTGTACTGATTTAGGGTTGAAGGAGGCCAAGGAGTTGGTGGAGAAAGCGCCTACCCTTTTGAAGAAGGGGGTGCCCAAGGAGGAGGCCGAGAAGATTATTGGGAAAATGAAGGAGGTTGGGGCTAAAGTGATTATGGAGTGA

Network for GWHGAAZE014890

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00542.20	Ribosomal_L12	53	118	9.00E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02935	RP-L7, MRPL12, rplL	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.565
	SRR3591706	second leaf	9.522
	SRR3591707	mature leaf	8.599
	SRR3591708	Shoot apex	30.248
	SRR3591709	Stem	16.334
	SRR3591710	White floral bud	33.212
	SRR3591711	White flower	26.511
	SRR3591712	Green floral bud	34.844
	SRR3591713	Yellow flower	19.165
SRP173429	SRR8316895	Juvenile bud stage	30.412
	SRR8316896	Juvenile bud stage	38.782
	SRR8316897	Juvenile bud stage	17.958
	SRR8316894	Third green stage	13.045
	SRR8316900	Third green stage	65.222
	SRR8316901	Third green stage	59.167
	SRR8316898	Complete white stage	25.714
	SRR8316899	Complete white stage	63.283
	SRR8316903	Complete white stage	30.818
	SRR8316902	Silver flowering stage	24.012
	SRR8316904	Silver flowering stage	30.064
	SRR8316905	Silver flowering stage	16.921
	SRR8316906	Gold flowering stage	42.614
	SRR8316907	Gold flowering stage	49.310
	SRR8316908	Gold flowering stage	43.407
SRP132670	SRR6706286	Control	81.148
	SRR6706287	Light intensity 50%	86.519
	SRR6706288	Light intensity 20%	94.113
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	49.670
	CNS0095593	Slightly white alabastrum(diploid) 2	60.055
	CNS0095594	Slightly white alabastrum(diploid) 3	47.610
	CNS0095595	Whole white alabastrum(diploid) 2	49.966
	CNS0095596	Whole white alabastrum(diploid) 3	63.753
	CNS0095597	Whole white alabastrum(diploid) 4	46.736
	CNS0095598	Silvery flower (diploied) 1	37.227
	CNS0095599	Silvery flower (diploied) 2	22.820
	CNS0095600	Silvery flower (diploied) 3	23.557
	CNS0095601	Golden flower (diploid) 1	25.605
	CNS0095602	Golden flower (diploid) 2	22.902
	CNS0095603	Golden flower (diploid) 3	23.083
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.189
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.659
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.328
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.185
	CNS0095608	Whole white alabastrum(tetraploid) 2	29.335
	CNS0095609	Whole white alabastrum(tetraploid) 3	37.384
	CNS0095610	Silvery flower (tetraploid) 1	20.095
	CNS0095611	Silvery flower (tetraploid) 2	14.222
	CNS0095612	Silvery flower (tetraploid) 3	21.173
	CNS0095613	Golden flower (tetraploid) 1	11.159
	CNS0095614	Golden flower (tetraploid) 2	17.744
	CNS0095615	Golden flower (tetraploid) 3	14.269
CRA001975	CRR073297	Stem 1	37.337
	CRR073298	Stem 2	41.351
	CRR073299	Stem 3	42.592
	CRR073300	Leaf 1	54.555
	CRR073301	Leaf 2	55.061
	CRR073302	Leaf 3	65.347
	CRR073303	Juvenile bud 1	58.076
	CRR073304	Juvenile bud 2	67.265
	CRR073305	Juvenile bud 3	59.037
	CRR073306	Third green 1	48.614
	CRR073307	Third green 2	42.251
	CRR073308	Third green 3	46.162
	CRR073309	Second white 1	36.974
	CRR073310	Second white 2	30.936
	CRR073311	Second white 3	16.822
	CRR073312	Silver flowering 1	16.007
	CRR073313	Silver flowering 2	13.377
	CRR073314	Silver flowering 3	13.414
	CRR073315	Gold flowering 1	28.396
	CRR073316	Gold flowering 2	26.486
	CRR073317	Gold flowering 3	23.283
	CRR073318	Tawny withering 1	35.036
	CRR073319	Tawny withering 2	29.305
	CRR073320	Tawny withering 3	31.595