Gene detail

Detail information of GWHGAAZE014921

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABK93797.1	8.32683E-43	unknown [Populus trichocarpa]
Swissprot	tr\|P0DH94\|VATL5_ARATH	1E-43	V-type proton ATPase subunit c5
trEMBL	tr\|A9PBP4\|A9PBP4_POPTR	3E-43	Putative uncharacterized protein {ECO:0000313\|EMBL:ABK93797.1}
TAIR10	AT1G75630.1	4E-35	vacuolar H+-pumping ATPase 16 kDa proteolipid subunit 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	21625703	21627223	-
GWHAAZE00000004	mRNA	21625703	21627223	-
GWHAAZE00000004	exon	21627164	21627223	-
GWHAAZE00000004	exon	21626987	21627102	-
GWHAAZE00000004	exon	21625703	21625826	-
GWHAAZE00000004	CDS	21627164	21627223	-
GWHAAZE00000004	CDS	21626987	21627102	-
GWHAAZE00000004	CDS	21625703	21625826	-

Transcript Sequence
>GWHTAAZE014935 ATGGGAGTGATGAGGCCGGGGCTTATAATGAAGTCAATCGTGCCTGTTGTCATGGCTGGAGCCAAATCATATTACCTCATTGATGGTTGCGCTCTCCTCTCTTCTGAACTCGCTTGCGATCTTGCCGGTCTATCCGCCGGAATGGCTATCAAAATCGTCGGCGATGCTGGTGTCGGAGCAAATGCACAACAGCCAAAGCCTTTCCTCAGAATGATTCTTACTCTTATCTTTGCGGAGGCGCTTGCTCTCTATGGACTTATCGTTGGCATCATCATCTCTTCTCACGCTGGCCAATCCTGA

Network for GWHGAAZE014921

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	37	92	7.00E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.186
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.276
	SRR3591709	Stem	1.120
	SRR3591710	White floral bud	2.582
	SRR3591711	White flower	0.661
	SRR3591712	Green floral bud	0.810
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.614
	SRR8316896	Juvenile bud stage	3.025
	SRR8316897	Juvenile bud stage	0.937
	SRR8316894	Third green stage	1.149
	SRR8316900	Third green stage	1.911
	SRR8316901	Third green stage	1.617
	SRR8316898	Complete white stage	6.362
	SRR8316899	Complete white stage	4.467
	SRR8316903	Complete white stage	9.538
	SRR8316902	Silver flowering stage	4.754
	SRR8316904	Silver flowering stage	5.563
	SRR8316905	Silver flowering stage	2.964
	SRR8316906	Gold flowering stage	7.071
	SRR8316907	Gold flowering stage	6.878
	SRR8316908	Gold flowering stage	2.235
SRP132670	SRR6706286	Control	2.187
	SRR6706287	Light intensity 50%	2.199
	SRR6706288	Light intensity 20%	2.695
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.471
	CNS0095593	Slightly white alabastrum(diploid) 2	4.539
	CNS0095594	Slightly white alabastrum(diploid) 3	4.015
	CNS0095595	Whole white alabastrum(diploid) 2	2.259
	CNS0095596	Whole white alabastrum(diploid) 3	1.435
	CNS0095597	Whole white alabastrum(diploid) 4	2.505
	CNS0095598	Silvery flower (diploied) 1	6.562
	CNS0095599	Silvery flower (diploied) 2	7.471
	CNS0095600	Silvery flower (diploied) 3	8.729
	CNS0095601	Golden flower (diploid) 1	4.386
	CNS0095602	Golden flower (diploid) 2	7.624
	CNS0095603	Golden flower (diploid) 3	4.115
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.224
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.454
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.676
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.534
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.153
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.763
	CNS0095610	Silvery flower (tetraploid) 1	1.229
	CNS0095611	Silvery flower (tetraploid) 2	0.594
	CNS0095612	Silvery flower (tetraploid) 3	0.368
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.122
	CNS0095615	Golden flower (tetraploid) 3	0.444
CRA001975	CRR073297	Stem 1	1.311
	CRR073298	Stem 2	3.806
	CRR073299	Stem 3	0.228
	CRR073300	Leaf 1	1.064
	CRR073301	Leaf 2	2.492
	CRR073302	Leaf 3	1.869
	CRR073303	Juvenile bud 1	1.780
	CRR073304	Juvenile bud 2	3.218
	CRR073305	Juvenile bud 3	1.985
	CRR073306	Third green 1	4.907
	CRR073307	Third green 2	2.073
	CRR073308	Third green 3	5.628
	CRR073309	Second white 1	0.560
	CRR073310	Second white 2	1.022
	CRR073311	Second white 3	0.861
	CRR073312	Silver flowering 1	0.468
	CRR073313	Silver flowering 2	0.108
	CRR073314	Silver flowering 3	0.238
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.142
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.203
	CRR073319	Tawny withering 2	2.735
	CRR073320	Tawny withering 3	3.550