Gene detail

Detail information of GWHGAAZE015146

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHN39463.1	1.83439E-89	Protein ODORANT1 [Glycine soja]
Swissprot	tr\|Q50EX6\|ODO1_PETHY	2E-83	Protein ODORANT1
trEMBL	tr\|I1MBV7\|I1MBV7_SOYBN	7E-90	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA14G39530.1}
TAIR10	AT5G16600.1	8E-62	myb domain protein 43

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	26223575	26225813	+
GWHAAZE00000004	mRNA	26223575	26225813	+
GWHAAZE00000004	exon	26223575	26223707	+
GWHAAZE00000004	exon	26224663	26224792	+
GWHAAZE00000004	exon	26225450	26225813	+
GWHAAZE00000004	CDS	26223575	26223707	+
GWHAAZE00000004	CDS	26224663	26224792	+
GWHAAZE00000004	CDS	26225450	26225813	+

Transcript Sequence
>GWHTAAZE015162 ATGGGAAGGCAACCATGCTGTGAGAAAGTGGGATTGAAGAAAGGGCCATGGACTTGTGAAGAGGACAAGACGCTCATCAACTTCATCCTCACCAATGGCCATTGCTGCTGGAGAGCTCTTCCCAAGCTTGCAGGACTGAAGAGATGTGGTAAAAGTTGTCGGCTGAGGTGGACAAATTATTTAAGACCTGACTTAAAGAGAGGTCTCCTCTCTGAATCTGAAGAGAACTTGGTCATTCAGCTTCATTCTCAACTTGGCAATAGATGGTCGAAAATTGCTTCTAACCTCCCGGGAAGAACAGACAATGAGATCAAGAATCACTGGAACACTCACATCAAGAAAAAATTAAAGAAAATGGGGATTGATCCTCTCACCCACAAGCCACTTCCTCCTACTACTCCAATTGATGAACCCAAAGAACAACTAGAAGAACAACAAGAAGTACAATATCAAGAAATGAATCAAATCAACAAAAAGGAAAATGACATTTCCTTGGAATATTCATCATCATTAACTACTACTACCAATATCACACATGAAACCATACAAGAAGACAAAAGTAGTACCATGGCAAGCCCATTAATGGAATTCAACATTAATGGCTTTTGCATAGATGAAGTCCACTGA

Network for GWHGAAZE015146

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	14	61	4.30E-11
PF00249.32	Myb_DNA-binding	71	111	2.60E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.942
	SRR3591706	second leaf	2.484
	SRR3591707	mature leaf	0.500
	SRR3591708	Shoot apex	10.026
	SRR3591709	Stem	41.743
	SRR3591710	White floral bud	3.610
	SRR3591711	White flower	15.097
	SRR3591712	Green floral bud	5.795
	SRR3591713	Yellow flower	16.103
SRP173429	SRR8316895	Juvenile bud stage	20.145
	SRR8316896	Juvenile bud stage	11.414
	SRR8316897	Juvenile bud stage	16.446
	SRR8316894	Third green stage	5.072
	SRR8316900	Third green stage	8.185
	SRR8316901	Third green stage	10.246
	SRR8316898	Complete white stage	1.265
	SRR8316899	Complete white stage	22.847
	SRR8316903	Complete white stage	1.203
	SRR8316902	Silver flowering stage	7.679
	SRR8316904	Silver flowering stage	11.547
	SRR8316905	Silver flowering stage	4.829
	SRR8316906	Gold flowering stage	21.525
	SRR8316907	Gold flowering stage	18.758
	SRR8316908	Gold flowering stage	30.240
SRP132670	SRR6706286	Control	3.018
	SRR6706287	Light intensity 50%	2.209
	SRR6706288	Light intensity 20%	1.714
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.770
	CNS0095593	Slightly white alabastrum(diploid) 2	19.398
	CNS0095594	Slightly white alabastrum(diploid) 3	14.117
	CNS0095595	Whole white alabastrum(diploid) 2	10.286
	CNS0095596	Whole white alabastrum(diploid) 3	1.458
	CNS0095597	Whole white alabastrum(diploid) 4	9.162
	CNS0095598	Silvery flower (diploied) 1	26.742
	CNS0095599	Silvery flower (diploied) 2	36.734
	CNS0095600	Silvery flower (diploied) 3	13.104
	CNS0095601	Golden flower (diploid) 1	23.816
	CNS0095602	Golden flower (diploid) 2	19.586
	CNS0095603	Golden flower (diploid) 3	17.046
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.770
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.561
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.523
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.246
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.908
	CNS0095610	Silvery flower (tetraploid) 1	0.940
	CNS0095611	Silvery flower (tetraploid) 2	0.792
	CNS0095612	Silvery flower (tetraploid) 3	29.693
	CNS0095613	Golden flower (tetraploid) 1	1.319
	CNS0095614	Golden flower (tetraploid) 2	1.494
	CNS0095615	Golden flower (tetraploid) 3	0.563
CRA001975	CRR073297	Stem 1	11.704
	CRR073298	Stem 2	13.449
	CRR073299	Stem 3	11.802
	CRR073300	Leaf 1	17.500
	CRR073301	Leaf 2	30.162
	CRR073302	Leaf 3	9.085
	CRR073303	Juvenile bud 1	15.124
	CRR073304	Juvenile bud 2	4.707
	CRR073305	Juvenile bud 3	25.129
	CRR073306	Third green 1	94.004
	CRR073307	Third green 2	42.544
	CRR073308	Third green 3	57.263
	CRR073309	Second white 1	103.440
	CRR073310	Second white 2	160.812
	CRR073311	Second white 3	180.614
	CRR073312	Silver flowering 1	150.351
	CRR073313	Silver flowering 2	117.634
	CRR073314	Silver flowering 3	144.162
	CRR073315	Gold flowering 1	2.413
	CRR073316	Gold flowering 2	3.215
	CRR073317	Gold flowering 3	3.223
	CRR073318	Tawny withering 1	8.625
	CRR073319	Tawny withering 2	8.486
	CRR073320	Tawny withering 3	22.398