Gene detail

Detail information of GWHGAAZE015158

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP01617.1	3.5936E-103	unnamed protein product [Coffea canephora]
Swissprot	tr\|P34802\|GGPP1_ARATH	3E-93	Heterodimeric geranylgeranyl pyrophosphate synthase large subunit 1, chloroplastic (Precursor)
trEMBL	tr\|A0A068TZZ2\|A0A068TZZ2_COFCA	1E-103	Coffea canephora DH200=94 genomic scaffold, scaffold_7 {ECO:0000313\|EMBL:CDP01617.1}
TAIR10	AT4G36810.1	3E-76	geranylgeranyl pyrophosphate synthase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	26453364	26453957	+
GWHAAZE00000004	mRNA	26453364	26453957	+
GWHAAZE00000004	exon	26453364	26453957	+
GWHAAZE00000004	CDS	26453364	26453957	+

Transcript Sequence
>GWHTAAZE015174 ATGGAACAAAAGGCAAAACTGGTGAACAAAGCCCTTGATGAGGCCATCCCATTGCGAAATCCGATCAAGATCCACGAGGCGATGCGATACTCCCTCCTTGCCGGAGGTAAACGCGTCCGCCCGATCCTATGTATCGCATCCTGTGAGCTGGTCGGCGGTGACGAGGCGCTGTCTATCCCGATGGCGTGCGCGGTGGAAATGATCCACACTATGTCGCTAATTCACGACGACCTGCCTTGCATGGACAACGATGACCTGCGCCGGGGCAGGCCTACCAGCCACAAGATGTACGGGGAGGACACTGCAGTCCTTGCCGGAGACGCACTATTGTCCTTTGCATTTGAGCACGTGGCTGCTACGGCTAAATCAGCCACCGGCTCAAACGCAACGGCCCGTGTCATCCGAGCTATAGCCGAGCTAGCCTCAGCCGTGGGCTCGGATGGACTAGTTGCCGGGCAAATAGTGGACATTTGCAGTGAGGGGAAAGAGGTTAGCCTAAACGATTTGGAATACATCCACATCCATAAAACCGCGAAGTTGTTAGAGGCCGCGGTGGTGTGCGGGTTCCCTCATAGGTGGCGGCACCACCGCTGA

Network for GWHGAAZE015158

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00348.18	polyprenyl_synt	24	188	1.60E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13789	GGPS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0008299	biological_process	isoprenoid biosynthetic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.136
	SRR3591709	Stem	0.150
	SRR3591710	White floral bud	91.169
	SRR3591711	White flower	143.452
	SRR3591712	Green floral bud	0.150
	SRR3591713	Yellow flower	84.391
SRP173429	SRR8316895	Juvenile bud stage	0.145
	SRR8316896	Juvenile bud stage	0.398
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.074
	SRR8316900	Third green stage	0.149
	SRR8316901	Third green stage	0.089
	SRR8316898	Complete white stage	14.602
	SRR8316899	Complete white stage	0.412
	SRR8316903	Complete white stage	25.062
	SRR8316902	Silver flowering stage	165.057
	SRR8316904	Silver flowering stage	183.259
	SRR8316905	Silver flowering stage	123.569
	SRR8316906	Gold flowering stage	276.939
	SRR8316907	Gold flowering stage	296.774
	SRR8316908	Gold flowering stage	185.781
SRP132670	SRR6706286	Control	0.594
	SRR6706287	Light intensity 50%	1.222
	SRR6706288	Light intensity 20%	0.160
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.199
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.773
	CNS0095595	Whole white alabastrum(diploid) 2	0.131
	CNS0095596	Whole white alabastrum(diploid) 3	0.101
	CNS0095597	Whole white alabastrum(diploid) 4	0.454
	CNS0095598	Silvery flower (diploied) 1	31.498
	CNS0095599	Silvery flower (diploied) 2	37.727
	CNS0095600	Silvery flower (diploied) 3	311.532
	CNS0095601	Golden flower (diploid) 1	61.666
	CNS0095602	Golden flower (diploid) 2	231.060
	CNS0095603	Golden flower (diploid) 3	232.324
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.195
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.219
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.087
	CNS0095610	Silvery flower (tetraploid) 1	97.212
	CNS0095611	Silvery flower (tetraploid) 2	145.683
	CNS0095612	Silvery flower (tetraploid) 3	1191.594
	CNS0095613	Golden flower (tetraploid) 1	328.372
	CNS0095614	Golden flower (tetraploid) 2	241.388
	CNS0095615	Golden flower (tetraploid) 3	369.638
CRA001975	CRR073297	Stem 1	0.889
	CRR073298	Stem 2	0.366
	CRR073299	Stem 3	0.617
	CRR073300	Leaf 1	0.586
	CRR073301	Leaf 2	0.821
	CRR073302	Leaf 3	0.454
	CRR073303	Juvenile bud 1	3.723
	CRR073304	Juvenile bud 2	4.082
	CRR073305	Juvenile bud 3	1.003
	CRR073306	Third green 1	630.142
	CRR073307	Third green 2	474.020
	CRR073308	Third green 3	433.986
	CRR073309	Second white 1	1355.590
	CRR073310	Second white 2	651.816
	CRR073311	Second white 3	603.884
	CRR073312	Silver flowering 1	337.726
	CRR073313	Silver flowering 2	361.477
	CRR073314	Silver flowering 3	299.314
	CRR073315	Gold flowering 1	0.030
	CRR073316	Gold flowering 2	0.612
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	27.098
	CRR073319	Tawny withering 2	53.407
	CRR073320	Tawny withering 3	1.262