Gene detail

Detail information of GWHGAAZE015172

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006380580.1	3.27227E-49	hypothetical protein POPTR_0007s09490g [Populus trichocarpa]
Swissprot	tr\|Q6YU51\|DXS2_ORYSJ	7E-50	Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic (Precursor)
trEMBL	tr\|U5GA89\|U5GA89_POPTR	1E-49	Uncharacterized protein {ECO:0000313\|EMBL:ERP58377.1}
TAIR10	AT3G21500.1	8E-40	1-deoxy-D-xylulose 5-phosphate synthase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	26933683	26933964	+
GWHAAZE00000004	mRNA	26933683	26933964	+
GWHAAZE00000004	exon	26933683	26933964	+
GWHAAZE00000004	CDS	26933683	26933964	+

Transcript Sequence
>GWHTAAZE015188 ATGAAGGTGGTGCATGATGTAGATCTTCAAAAGTTACCCATCCTATTCGCAATGGATCGAGCTGGTTTAGTGGGTGCAGACAGGCCGACCCATTGTGGGGCATTTGACATCGCGTACGTGGCTTGCTTGCCCAACATGGTGGTAATGGCTCCATCAGATGAAGCTGAGCTTATGCACATAGTTGCCACGGCTGCAGCCATTGATGATAGACCGAGTTGCTTTAGTTTCCTGAGGGGTAATGGAATAGGAGCCATTCTTCCACCTAATAACAATACCAATTGA

Network for GWHGAAZE015172

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02779.25	Transket_pyr	3	80	3.00E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01662	dxs	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Thiamine metabolism	map00730
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.244
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.286
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.027
	SRR8316898	Complete white stage	0.034
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.169
	SRR8316902	Silver flowering stage	0.113
	SRR8316904	Silver flowering stage	1.780
	SRR8316905	Silver flowering stage	0.088
	SRR8316906	Gold flowering stage	0.705
	SRR8316907	Gold flowering stage	0.337
	SRR8316908	Gold flowering stage	0.735
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	1.521
	CNS0095601	Golden flower (diploid) 1	0.197
	CNS0095602	Golden flower (diploid) 2	0.037
	CNS0095603	Golden flower (diploid) 3	0.091
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.308
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.528
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.144
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.845
	CNS0095610	Silvery flower (tetraploid) 1	0.460
	CNS0095611	Silvery flower (tetraploid) 2	0.425
	CNS0095612	Silvery flower (tetraploid) 3	1.959
	CNS0095613	Golden flower (tetraploid) 1	0.819
	CNS0095614	Golden flower (tetraploid) 2	0.252
	CNS0095615	Golden flower (tetraploid) 3	0.770
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.021
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.034
	CRR073306	Third green 1	3.193
	CRR073307	Third green 2	0.468
	CRR073308	Third green 3	4.257
	CRR073309	Second white 1	5.130
	CRR073310	Second white 2	5.496
	CRR073311	Second white 3	1.650
	CRR073312	Silver flowering 1	4.492
	CRR073313	Silver flowering 2	1.529
	CRR073314	Silver flowering 3	1.414
	CRR073315	Gold flowering 1	0.091
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000