Gene detail

Detail information of GWHGAAZE015320

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG30732.1	3.10008E-66	Transcription initiation factor TFIID subunit taf73 [Gossypium arboreum]
trEMBL	tr\|A0A061GLW7\|A0A061GLW7_THECC	9E-66	Mitochondrial ATP synthase subunit G protein {ECO:0000313\|EMBL:EOY30526.1}
TAIR10	AT4G29480.1	2E-42	Mitochondrial ATP synthase subunit G protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	31392274	31395692	-
GWHAAZE00000004	mRNA	31392274	31395692	-
GWHAAZE00000004	exon	31392274	31392460	-
GWHAAZE00000004	exon	31395346	31395692	-
GWHAAZE00000004	CDS	31395346	31395692	-
GWHAAZE00000004	CDS	31392274	31392460	-

Transcript Sequence
>GWHTAAZE015336 ATGGCGTCACAGTTGCAAAAGTTGCAGCAGTTGCAATCGAAGGCATGTCAAGCTTCACAATTTGTGGCCAAGCATGGCACCAGTTACTACAAGCAGTTGTTGGAGCAGAACAAGCAATATATCCAGGAGCCCCCTACTGTAGAGAAATGCAACCAGTTGTCTAAGCAGCTGTTCTACACTCGTCTTGCTAGGTTGCTTTTTCTACCCCTATTTGATTCTTCCCAGTGGATCTGTTTATACCAGCTTGTTATTTCTTGTTTTAATTATGCAACCATGATTTCAGGCCTGAGAAGCATGGGTTTATACCAGTTATCTGTGCTTCATAGCATCAGGCAGCTTGTAAACAATATTCCTGGCCGACAAGAAGCGTTTTGGAAGGAAGTTGATTACTTGAAGAACGCATGGAAGAACAGGCAGGAGCTGAAGGTGGAGGATGCTGGCATTGCTGCCTTGTTTGGCCTCGAGTGCTTTGCTTGGTTTTGTGCTGGCGAGATTGTGGGAAGGGGCTTCACATTCACCGGTTACTACGTTTAA

Network for GWHGAAZE015320

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0187

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04718.16	ATP-synt_G	18	175	2.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02140	ATPeFG, ATP5L, ATP20	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0000276	cellular_component	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	96.450
	SRR3591706	second leaf	51.730
	SRR3591707	mature leaf	31.229
	SRR3591708	Shoot apex	88.972
	SRR3591709	Stem	65.400
	SRR3591710	White floral bud	62.741
	SRR3591711	White flower	76.765
	SRR3591712	Green floral bud	113.775
	SRR3591713	Yellow flower	62.425
SRP173429	SRR8316895	Juvenile bud stage	56.234
	SRR8316896	Juvenile bud stage	81.595
	SRR8316897	Juvenile bud stage	39.912
	SRR8316894	Third green stage	36.395
	SRR8316900	Third green stage	125.026
	SRR8316901	Third green stage	127.287
	SRR8316898	Complete white stage	37.828
	SRR8316899	Complete white stage	90.963
	SRR8316903	Complete white stage	48.069
	SRR8316902	Silver flowering stage	48.070
	SRR8316904	Silver flowering stage	40.995
	SRR8316905	Silver flowering stage	21.975
	SRR8316906	Gold flowering stage	70.345
	SRR8316907	Gold flowering stage	98.904
	SRR8316908	Gold flowering stage	80.217
SRP132670	SRR6706286	Control	130.493
	SRR6706287	Light intensity 50%	133.316
	SRR6706288	Light intensity 20%	127.959
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	108.053
	CNS0095593	Slightly white alabastrum(diploid) 2	120.443
	CNS0095594	Slightly white alabastrum(diploid) 3	115.494
	CNS0095595	Whole white alabastrum(diploid) 2	114.176
	CNS0095596	Whole white alabastrum(diploid) 3	134.382
	CNS0095597	Whole white alabastrum(diploid) 4	100.114
	CNS0095598	Silvery flower (diploied) 1	52.733
	CNS0095599	Silvery flower (diploied) 2	56.652
	CNS0095600	Silvery flower (diploied) 3	68.680
	CNS0095601	Golden flower (diploid) 1	45.130
	CNS0095602	Golden flower (diploid) 2	50.211
	CNS0095603	Golden flower (diploid) 3	53.175
	CNS0095604	Slightly white alabastrum(tetraploid) 1	124.295
	CNS0095605	Slightly white alabastrum(tetraploid) 2	113.474
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.421
	CNS0095607	Whole white alabastrum(tetraploid) 1	102.669
	CNS0095608	Whole white alabastrum(tetraploid) 2	81.765
	CNS0095609	Whole white alabastrum(tetraploid) 3	85.267
	CNS0095610	Silvery flower (tetraploid) 1	56.440
	CNS0095611	Silvery flower (tetraploid) 2	46.899
	CNS0095612	Silvery flower (tetraploid) 3	44.693
	CNS0095613	Golden flower (tetraploid) 1	35.511
	CNS0095614	Golden flower (tetraploid) 2	44.120
	CNS0095615	Golden flower (tetraploid) 3	21.119
CRA001975	CRR073297	Stem 1	55.430
	CRR073298	Stem 2	52.673
	CRR073299	Stem 3	64.548
	CRR073300	Leaf 1	60.266
	CRR073301	Leaf 2	66.087
	CRR073302	Leaf 3	75.909
	CRR073303	Juvenile bud 1	61.764
	CRR073304	Juvenile bud 2	58.116
	CRR073305	Juvenile bud 3	65.181
	CRR073306	Third green 1	47.964
	CRR073307	Third green 2	44.570
	CRR073308	Third green 3	36.166
	CRR073309	Second white 1	43.428
	CRR073310	Second white 2	32.847
	CRR073311	Second white 3	22.134
	CRR073312	Silver flowering 1	25.248
	CRR073313	Silver flowering 2	32.334
	CRR073314	Silver flowering 3	23.118
	CRR073315	Gold flowering 1	21.992
	CRR073316	Gold flowering 2	19.187
	CRR073317	Gold flowering 3	27.112
	CRR073318	Tawny withering 1	45.493
	CRR073319	Tawny withering 2	45.942
	CRR073320	Tawny withering 3	42.493