Gene detail

Detail information of GWHGAAZE015405

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP03254.1	6.00245E-79	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SZE1\|3HID1_ARATH	2E-74	Probable 3-hydroxyisobutyrate dehydrogenase-like 1, mitochondrial (Precursor)
trEMBL	tr\|A0A068U523\|A0A068U523_COFCA	2E-79	Coffea canephora DH200=94 genomic scaffold, scaffold_9 {ECO:0000313\|EMBL:CDP03254.1}
TAIR10	AT4G29120.1	3E-54	6-phosphogluconate dehydrogenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	38080268	38080735	-
GWHAAZE00000004	mRNA	38080268	38080735	-
GWHAAZE00000004	exon	38080268	38080735	-
GWHAAZE00000004	CDS	38080268	38080735	-

Transcript Sequence
>GWHTAAZE015421 ATGGGCCAATCCATGTGCACCCACCTAATCAAAGCCGGCTACACCCTCACTATCTTCACCCGCACCCAATCCAAATCCCAACCCCTCTTAAACATGGGCGCCACGTGGGCCCCATCCCCTCACTCGGTCGCTACTCAATCCGACGTCGTTTTCTCTATCGTGGGCTACCCTTCCGATGTCCGCCACGTCATCCTCCACCCCTCCAGTGGGGCCCTCTCCGGGCTCAACCCCGGCGGAGTTGTCGTGGATATGACCACTTCTGACCCTTCCCTCGCCGTTGAGATAGCCGGCGCTGCTAAAGCTAAGTCTTGCGCCGCCATTGACGCCCCCGTCTCCGGCGGAGACCGGGGTGCCCGGAATGCAGCGCTGTCAATCTTCGCCGGCGGCGACGAAGCCGTGATTTCGCGGCTTCAGCCGATCTTTGCGCTTTTGGGAAAAGTCAATTACATGGGCGGACCAGGTAAATGA

Network for GWHGAAZE015405

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0102

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03446.16	NAD_binding_2	1	148	1.70E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00020	HIBADH, mmsB	Metabolic pathways	map01100
K00020	HIBADH, mmsB	Valine, leucine and isoleucine degradation	map00280

Gene Ontology

GO term	Ontology	Name
GO:0050661	molecular_function	NADP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.521
	SRR3591706	second leaf	10.002
	SRR3591707	mature leaf	10.936
	SRR3591708	Shoot apex	11.716
	SRR3591709	Stem	13.419
	SRR3591710	White floral bud	8.918
	SRR3591711	White flower	6.434
	SRR3591712	Green floral bud	15.408
	SRR3591713	Yellow flower	4.364
SRP173429	SRR8316895	Juvenile bud stage	19.197
	SRR8316896	Juvenile bud stage	26.725
	SRR8316897	Juvenile bud stage	12.361
	SRR8316894	Third green stage	8.116
	SRR8316900	Third green stage	31.669
	SRR8316901	Third green stage	29.961
	SRR8316898	Complete white stage	9.927
	SRR8316899	Complete white stage	45.094
	SRR8316903	Complete white stage	17.068
	SRR8316902	Silver flowering stage	5.144
	SRR8316904	Silver flowering stage	7.972
	SRR8316905	Silver flowering stage	3.758
	SRR8316906	Gold flowering stage	9.254
	SRR8316907	Gold flowering stage	13.086
	SRR8316908	Gold flowering stage	12.809
SRP132670	SRR6706286	Control	29.344
	SRR6706287	Light intensity 50%	27.483
	SRR6706288	Light intensity 20%	34.194
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.797
	CNS0095593	Slightly white alabastrum(diploid) 2	23.526
	CNS0095594	Slightly white alabastrum(diploid) 3	20.931
	CNS0095595	Whole white alabastrum(diploid) 2	21.527
	CNS0095596	Whole white alabastrum(diploid) 3	20.691
	CNS0095597	Whole white alabastrum(diploid) 4	21.556
	CNS0095598	Silvery flower (diploied) 1	21.481
	CNS0095599	Silvery flower (diploied) 2	17.934
	CNS0095600	Silvery flower (diploied) 3	27.878
	CNS0095601	Golden flower (diploid) 1	15.349
	CNS0095602	Golden flower (diploid) 2	30.712
	CNS0095603	Golden flower (diploid) 3	27.617
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.957
	CNS0095605	Slightly white alabastrum(tetraploid) 2	19.487
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.552
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.509
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.449
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.478
	CNS0095610	Silvery flower (tetraploid) 1	8.532
	CNS0095611	Silvery flower (tetraploid) 2	11.993
	CNS0095612	Silvery flower (tetraploid) 3	7.449
	CNS0095613	Golden flower (tetraploid) 1	3.700
	CNS0095614	Golden flower (tetraploid) 2	6.171
	CNS0095615	Golden flower (tetraploid) 3	2.623
CRA001975	CRR073297	Stem 1	32.134
	CRR073298	Stem 2	37.031
	CRR073299	Stem 3	50.571
	CRR073300	Leaf 1	49.311
	CRR073301	Leaf 2	38.500
	CRR073302	Leaf 3	43.378
	CRR073303	Juvenile bud 1	64.096
	CRR073304	Juvenile bud 2	66.873
	CRR073305	Juvenile bud 3	65.206
	CRR073306	Third green 1	13.535
	CRR073307	Third green 2	16.582
	CRR073308	Third green 3	13.677
	CRR073309	Second white 1	11.279
	CRR073310	Second white 2	12.407
	CRR073311	Second white 3	3.882
	CRR073312	Silver flowering 1	6.309
	CRR073313	Silver flowering 2	6.436
	CRR073314	Silver flowering 3	3.714
	CRR073315	Gold flowering 1	61.114
	CRR073316	Gold flowering 2	71.831
	CRR073317	Gold flowering 3	66.077
	CRR073318	Tawny withering 1	48.732
	CRR073319	Tawny withering 2	42.801
	CRR073320	Tawny withering 3	40.456