Gene detail

Detail information of GWHGAAZE015533

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008349228.1	5.15469E-57	PREDICTED: 12-oxophytodienoate reductase 2-like [Malus domestica]
Swissprot	tr\|Q9XG54\|OPR1_SOLLC	2E-53	12-oxophytodienoate reductase 1
trEMBL	tr\|M5XZ67\|M5XZ67_PRUPE	2E-57	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24570.1}
TAIR10	AT1G76690.1	3E-43	12-oxophytodienoate reductase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	45983452	45983763	+
GWHAAZE00000004	mRNA	45983452	45983763	+
GWHAAZE00000004	exon	45983452	45983763	+
GWHAAZE00000004	CDS	45983452	45983763	+

Transcript Sequence
>GWHTAAZE015549 ATGGTTGAGCCGAGGATGAAAACTGTAGGTGAGAAAAGCGAAAGTGCCCATAGCCTTGTGCCCATGAGGAAAGCTTTTAAAGGTACTTTCATAAGTGCTGGCGGGTTTGATAGGGAAGATGGCAACAAAGCCGTGGCCGAGAAGCGGACAGATCTTGTTGCTTATGGTCGGTTGTTCTTAGCAAACCCGGATTTGCCAAAGAGGTTTGAGCTCAATGCGCCACTCAACAAGTACAACAGGGATACATTCTATGTTCCTGAACCTGTTATTGGCTACACTGATTATCCATTTCTTGAAACAGCAACTGATTAA

Network for GWHGAAZE015533

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0089

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00724.21	Oxidored_FMN	5	75	7.90E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05894	OPR	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0003824	molecular_function	catalytic activity
GO:0010181	molecular_function	FMN binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.767
	SRR3591706	second leaf	4.896
	SRR3591707	mature leaf	4.556
	SRR3591708	Shoot apex	5.963
	SRR3591709	Stem	18.329
	SRR3591710	White floral bud	15.086
	SRR3591711	White flower	32.671
	SRR3591712	Green floral bud	21.196
	SRR3591713	Yellow flower	48.276
SRP173429	SRR8316895	Juvenile bud stage	3.867
	SRR8316896	Juvenile bud stage	10.106
	SRR8316897	Juvenile bud stage	3.395
	SRR8316894	Third green stage	5.871
	SRR8316900	Third green stage	13.816
	SRR8316901	Third green stage	19.068
	SRR8316898	Complete white stage	6.237
	SRR8316899	Complete white stage	23.412
	SRR8316903	Complete white stage	5.256
	SRR8316902	Silver flowering stage	13.591
	SRR8316904	Silver flowering stage	17.656
	SRR8316905	Silver flowering stage	15.037
	SRR8316906	Gold flowering stage	30.709
	SRR8316907	Gold flowering stage	42.424
	SRR8316908	Gold flowering stage	41.021
SRP132670	SRR6706286	Control	9.236
	SRR6706287	Light intensity 50%	5.836
	SRR6706288	Light intensity 20%	6.624
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.978
	CNS0095593	Slightly white alabastrum(diploid) 2	71.235
	CNS0095594	Slightly white alabastrum(diploid) 3	51.637
	CNS0095595	Whole white alabastrum(diploid) 2	60.201
	CNS0095596	Whole white alabastrum(diploid) 3	45.767
	CNS0095597	Whole white alabastrum(diploid) 4	75.342
	CNS0095598	Silvery flower (diploied) 1	17.111
	CNS0095599	Silvery flower (diploied) 2	12.881
	CNS0095600	Silvery flower (diploied) 3	19.146
	CNS0095601	Golden flower (diploid) 1	11.018
	CNS0095602	Golden flower (diploid) 2	12.452
	CNS0095603	Golden flower (diploid) 3	23.829
	CNS0095604	Slightly white alabastrum(tetraploid) 1	64.904
	CNS0095605	Slightly white alabastrum(tetraploid) 2	72.890
	CNS0095606	Slightly white alabastrum(tetraploid) 3	67.881
	CNS0095607	Whole white alabastrum(tetraploid) 1	68.334
	CNS0095608	Whole white alabastrum(tetraploid) 2	87.420
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.291
	CNS0095610	Silvery flower (tetraploid) 1	104.219
	CNS0095611	Silvery flower (tetraploid) 2	70.380
	CNS0095612	Silvery flower (tetraploid) 3	71.596
	CNS0095613	Golden flower (tetraploid) 1	71.471
	CNS0095614	Golden flower (tetraploid) 2	57.613
	CNS0095615	Golden flower (tetraploid) 3	35.980
CRA001975	CRR073297	Stem 1	8.882
	CRR073298	Stem 2	9.279
	CRR073299	Stem 3	11.571
	CRR073300	Leaf 1	16.363
	CRR073301	Leaf 2	15.935
	CRR073302	Leaf 3	18.951
	CRR073303	Juvenile bud 1	25.417
	CRR073304	Juvenile bud 2	21.615
	CRR073305	Juvenile bud 3	19.465
	CRR073306	Third green 1	13.748
	CRR073307	Third green 2	7.521
	CRR073308	Third green 3	4.786
	CRR073309	Second white 1	23.746
	CRR073310	Second white 2	18.192
	CRR073311	Second white 3	9.941
	CRR073312	Silver flowering 1	10.946
	CRR073313	Silver flowering 2	11.843
	CRR073314	Silver flowering 3	6.268
	CRR073315	Gold flowering 1	6.781
	CRR073316	Gold flowering 2	6.173
	CRR073317	Gold flowering 3	2.572
	CRR073318	Tawny withering 1	13.192
	CRR073319	Tawny withering 2	30.656
	CRR073320	Tawny withering 3	6.078