Gene detail

Detail information of GWHGAAZE015602

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP17245.1	2.52561E-88	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068V936\|A0A068V936_COFCA	9E-89	Coffea canephora DH200=94 genomic scaffold, scaffold_149 {ECO:0000313\|EMBL:CDP17245.1}
TAIR10	AT4G09620.1	2E-51	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	50134296	50134820	+
GWHAAZE00000004	mRNA	50134296	50134820	+
GWHAAZE00000004	exon	50134296	50134820	+
GWHAAZE00000004	CDS	50134296	50134820	+

Transcript Sequence
>GWHTAAZE015618 GTTGTTCCACAAAGTGTGAGCCGAGGACCTTGGACCTCCATTTGTGTGTCTAAAAAATGGGAAACGCATTCAGCTCCAAAATCTGGAACCATAGTCCTAAGTGACGAAGAGAAGAAAACATGGGACTTAAGTAGACAAGCTTTATCCCCATTTGAATTTAGCGCCGAAGAGGAAGACAAAATACTGGGAAAAGCATTCGGACATGCCCATTCACCGTACTGGAGTGAAGAACGAAAGAAAGAAGTGCCCCAATTCGAAGTAGTTAATGAAATATTGAATTATTTGAGGAGTTTAAGTCTCACTGACGAAGATCTTAGCAAATTGCTAAAGAAATTCCCGGAAGTTGTTGGGTGTGATCTTGAAGAAGAGGTGAAGAACAATGTGAAAGTTTTGGAGAAAGTGTGGGGGATTAAAGGGAAGTCTTTAAGGAGTCTTTTGCTTCGAAATCCAAAAGTTTTGGGTTTTAATGTTGATTGTAAAGGGGATTGTATGGCGCAATGCACACGCTGCTGGGTTCGGTTTTAG

Network for GWHGAAZE015602

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	92	158	4.00E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.212
	SRR3591706	second leaf	49.334
	SRR3591707	mature leaf	69.250
	SRR3591708	Shoot apex	23.089
	SRR3591709	Stem	14.068
	SRR3591710	White floral bud	13.966
	SRR3591711	White flower	21.102
	SRR3591712	Green floral bud	24.656
	SRR3591713	Yellow flower	20.541
SRP173429	SRR8316895	Juvenile bud stage	15.181
	SRR8316896	Juvenile bud stage	20.977
	SRR8316897	Juvenile bud stage	9.743
	SRR8316894	Third green stage	10.494
	SRR8316900	Third green stage	42.301
	SRR8316901	Third green stage	38.442
	SRR8316898	Complete white stage	11.224
	SRR8316899	Complete white stage	38.963
	SRR8316903	Complete white stage	14.665
	SRR8316902	Silver flowering stage	8.453
	SRR8316904	Silver flowering stage	11.151
	SRR8316905	Silver flowering stage	7.375
	SRR8316906	Gold flowering stage	17.084
	SRR8316907	Gold flowering stage	22.504
	SRR8316908	Gold flowering stage	18.086
SRP132670	SRR6706286	Control	23.401
	SRR6706287	Light intensity 50%	25.420
	SRR6706288	Light intensity 20%	30.351
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.146
	CNS0095593	Slightly white alabastrum(diploid) 2	22.803
	CNS0095594	Slightly white alabastrum(diploid) 3	18.551
	CNS0095595	Whole white alabastrum(diploid) 2	19.391
	CNS0095596	Whole white alabastrum(diploid) 3	26.685
	CNS0095597	Whole white alabastrum(diploid) 4	21.541
	CNS0095598	Silvery flower (diploied) 1	31.963
	CNS0095599	Silvery flower (diploied) 2	24.594
	CNS0095600	Silvery flower (diploied) 3	23.614
	CNS0095601	Golden flower (diploid) 1	23.993
	CNS0095602	Golden flower (diploid) 2	22.657
	CNS0095603	Golden flower (diploid) 3	23.342
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.337
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.888
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.620
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.096
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.309
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.981
	CNS0095610	Silvery flower (tetraploid) 1	18.405
	CNS0095611	Silvery flower (tetraploid) 2	21.032
	CNS0095612	Silvery flower (tetraploid) 3	7.724
	CNS0095613	Golden flower (tetraploid) 1	11.492
	CNS0095614	Golden flower (tetraploid) 2	20.974
	CNS0095615	Golden flower (tetraploid) 3	10.068
CRA001975	CRR073297	Stem 1	15.496
	CRR073298	Stem 2	16.342
	CRR073299	Stem 3	13.172
	CRR073300	Leaf 1	19.247
	CRR073301	Leaf 2	20.258
	CRR073302	Leaf 3	23.017
	CRR073303	Juvenile bud 1	25.332
	CRR073304	Juvenile bud 2	17.006
	CRR073305	Juvenile bud 3	12.907
	CRR073306	Third green 1	2.065
	CRR073307	Third green 2	3.471
	CRR073308	Third green 3	5.175
	CRR073309	Second white 1	4.904
	CRR073310	Second white 2	4.906
	CRR073311	Second white 3	4.843
	CRR073312	Silver flowering 1	2.455
	CRR073313	Silver flowering 2	3.939
	CRR073314	Silver flowering 3	1.695
	CRR073315	Gold flowering 1	33.647
	CRR073316	Gold flowering 2	47.329
	CRR073317	Gold flowering 3	25.817
	CRR073318	Tawny withering 1	8.699
	CRR073319	Tawny withering 2	12.989
	CRR073320	Tawny withering 3	10.616