Gene detail

Detail information of GWHGAAZE015605

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010256399.1	1.63853E-61	PREDICTED: 50S ribosomal protein L21, chloroplastic [Nelumbo nucifera]
Swissprot	tr\|P51412\|RK21_ARATH	2E-48	50S ribosomal protein L21, chloroplastic (Precursor)
trEMBL	tr\|K4C7G8\|K4C7G8_SOLLC	5E-59	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc06g065390.2.1}
TAIR10	AT1G35680.1	1E-35	Ribosomal protein L21

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	50259798	50265163	-
GWHAAZE00000004	mRNA	50259798	50265163	-
GWHAAZE00000004	exon	50264843	50265163	-
GWHAAZE00000004	exon	50262322	50262402	-
GWHAAZE00000004	exon	50259987	50260088	-
GWHAAZE00000004	exon	50259798	50259878	-
GWHAAZE00000004	CDS	50264843	50265163	-
GWHAAZE00000004	CDS	50262322	50262402	-
GWHAAZE00000004	CDS	50259987	50260088	-
GWHAAZE00000004	CDS	50259798	50259878	-

Transcript Sequence
>GWHTAAZE015621 ATGGCGACCCTTTCTTACTGTTCTCTCACAACAACAACACTATCCCACAAACAATCTACTACTCAAACCCTAATTCTTCCTCACTCTAAAATAAATCTTGGGTTTCTCTCTCCTCCTCCTCCTCCACTTCACTCTCTCTCTTCCTCCCTCAAGCTCACCACTTCATCTCCATTCTCCTCATTGTCTTTCGTTCCCAAATCCTCTGAAATTGAAGCACCCGTCGTTGAATCCGAACCGGTTTCGGCCCAAATTGAGCCGGCCGAGGTCTTGGAAACCGCAGTTGCAGAGCCCAAACCCGAGCAGGTCTTTGCTGTTGTCGTGATCGGGTCCCGACAATATATTGTTTTTCCTGGACGGTTTCTATATACGCAGAGGCTTAAAGGTGCAAATGTAAACGATAAAATTATTCTGAACAAGGTCTTGCTGGTGGGAACAAAGACTAAACTTTGGATTGGGTATCCTGTGGTGACTAATGCAGCCGTACATGCCGTAGTTGAAGAACATGGTTTGAATGACAAAGTCGTCGTCTTCAAATATAAGAAGAAAAAGAACTACAGAAGGAACATTGGTCACCGACAGGTATAA

Network for GWHGAAZE015605

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00829.22	Ribosomal_L21p	103	193	3.00E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02888	RP-L21, MRPL21, rplU	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	75.860
	SRR3591706	second leaf	144.232
	SRR3591707	mature leaf	76.529
	SRR3591708	Shoot apex	151.525
	SRR3591709	Stem	21.245
	SRR3591710	White floral bud	28.470
	SRR3591711	White flower	42.174
	SRR3591712	Green floral bud	58.943
	SRR3591713	Yellow flower	65.627
SRP173429	SRR8316895	Juvenile bud stage	48.331
	SRR8316896	Juvenile bud stage	54.083
	SRR8316897	Juvenile bud stage	33.471
	SRR8316894	Third green stage	22.655
	SRR8316900	Third green stage	68.851
	SRR8316901	Third green stage	61.309
	SRR8316898	Complete white stage	17.568
	SRR8316899	Complete white stage	50.625
	SRR8316903	Complete white stage	29.929
	SRR8316902	Silver flowering stage	41.617
	SRR8316904	Silver flowering stage	49.411
	SRR8316905	Silver flowering stage	41.313
	SRR8316906	Gold flowering stage	114.392
	SRR8316907	Gold flowering stage	83.746
	SRR8316908	Gold flowering stage	126.502
SRP132670	SRR6706286	Control	53.034
	SRR6706287	Light intensity 50%	52.121
	SRR6706288	Light intensity 20%	59.808
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.381
	CNS0095593	Slightly white alabastrum(diploid) 2	37.620
	CNS0095594	Slightly white alabastrum(diploid) 3	34.402
	CNS0095595	Whole white alabastrum(diploid) 2	32.466
	CNS0095596	Whole white alabastrum(diploid) 3	41.073
	CNS0095597	Whole white alabastrum(diploid) 4	29.079
	CNS0095598	Silvery flower (diploied) 1	100.535
	CNS0095599	Silvery flower (diploied) 2	82.920
	CNS0095600	Silvery flower (diploied) 3	141.252
	CNS0095601	Golden flower (diploid) 1	129.295
	CNS0095602	Golden flower (diploid) 2	173.667
	CNS0095603	Golden flower (diploid) 3	162.778
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.909
	CNS0095605	Slightly white alabastrum(tetraploid) 2	37.053
	CNS0095606	Slightly white alabastrum(tetraploid) 3	60.485
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.697
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.261
	CNS0095609	Whole white alabastrum(tetraploid) 3	52.655
	CNS0095610	Silvery flower (tetraploid) 1	63.690
	CNS0095611	Silvery flower (tetraploid) 2	102.784
	CNS0095612	Silvery flower (tetraploid) 3	116.288
	CNS0095613	Golden flower (tetraploid) 1	43.064
	CNS0095614	Golden flower (tetraploid) 2	78.311
	CNS0095615	Golden flower (tetraploid) 3	165.403
CRA001975	CRR073297	Stem 1	90.137
	CRR073298	Stem 2	87.183
	CRR073299	Stem 3	104.675
	CRR073300	Leaf 1	59.029
	CRR073301	Leaf 2	62.256
	CRR073302	Leaf 3	63.319
	CRR073303	Juvenile bud 1	57.989
	CRR073304	Juvenile bud 2	53.602
	CRR073305	Juvenile bud 3	58.682
	CRR073306	Third green 1	18.579
	CRR073307	Third green 2	12.903
	CRR073308	Third green 3	16.862
	CRR073309	Second white 1	108.241
	CRR073310	Second white 2	59.329
	CRR073311	Second white 3	52.725
	CRR073312	Silver flowering 1	83.463
	CRR073313	Silver flowering 2	101.025
	CRR073314	Silver flowering 3	78.239
	CRR073315	Gold flowering 1	220.853
	CRR073316	Gold flowering 2	252.644
	CRR073317	Gold flowering 3	212.382
	CRR073318	Tawny withering 1	52.912
	CRR073319	Tawny withering 2	42.295
	CRR073320	Tawny withering 3	54.449