Gene detail

Detail information of GWHGAAZE016090

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFK40516.1	1.14836E-58	unknown [Lotus japonicus]
Swissprot	tr\|P48384\|TRXM_PEA	9E-57	Thioredoxin M-type, chloroplastic (Precursor)
trEMBL	tr\|I3SJS4\|I3SJS4_LOTJA	4E-59	Uncharacterized protein {ECO:0000313\|EMBL:AFK40516.1}
TAIR10	AT4G03520.1	8E-37	Thioredoxin superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	68996742	68997062	+
GWHAAZE00000004	mRNA	68996742	68997062	+
GWHAAZE00000004	exon	68996742	68997062	+
GWHAAZE00000004	CDS	68996742	68997062	+

Transcript Sequence
>GWHTAAZE016110 GTTAAAGTGGTGACGGAGTCGAGCTGGGACGAACTCGTACTGAAAAGCAAAACCCTAGTTCTAGTAGACTTCTGGGCGCCATGGTGCGGTCCTTGTCGGATGATAGCGCCGGTGATTGACGAGCTGGCTAAAGAATACACCGGAAAACTCACATGTTATAAGCTGAACACAGATGATAGCCCAGGCATAGCATCACAATTTGGAATAAGGAGTATCCCGACGGTGTTGTTCTTCAAAAGTGGAGAGAAGAAAGAGAGTGTGATTGGTGCTGTCCCAAAGTCTACTCTCACTGCTACAATTGAGAAGTATTTGGAGGGTTGA

Network for GWHGAAZE016090

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	1	102	8.50E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	214.297
	SRR3591706	second leaf	1060.935
	SRR3591707	mature leaf	985.741
	SRR3591708	Shoot apex	464.895
	SRR3591709	Stem	159.437
	SRR3591710	White floral bud	89.473
	SRR3591711	White flower	75.652
	SRR3591712	Green floral bud	126.266
	SRR3591713	Yellow flower	39.758
SRP173429	SRR8316895	Juvenile bud stage	146.670
	SRR8316896	Juvenile bud stage	146.851
	SRR8316897	Juvenile bud stage	106.731
	SRR8316894	Third green stage	58.708
	SRR8316900	Third green stage	176.859
	SRR8316901	Third green stage	182.377
	SRR8316898	Complete white stage	52.893
	SRR8316899	Complete white stage	168.352
	SRR8316903	Complete white stage	58.756
	SRR8316902	Silver flowering stage	31.779
	SRR8316904	Silver flowering stage	38.972
	SRR8316905	Silver flowering stage	19.746
	SRR8316906	Gold flowering stage	30.772
	SRR8316907	Gold flowering stage	37.801
	SRR8316908	Gold flowering stage	56.124
SRP132670	SRR6706286	Control	195.341
	SRR6706287	Light intensity 50%	178.315
	SRR6706288	Light intensity 20%	195.735
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	165.508
	CNS0095593	Slightly white alabastrum(diploid) 2	170.556
	CNS0095594	Slightly white alabastrum(diploid) 3	146.088
	CNS0095595	Whole white alabastrum(diploid) 2	147.536
	CNS0095596	Whole white alabastrum(diploid) 3	148.897
	CNS0095597	Whole white alabastrum(diploid) 4	122.685
	CNS0095598	Silvery flower (diploied) 1	160.625
	CNS0095599	Silvery flower (diploied) 2	147.278
	CNS0095600	Silvery flower (diploied) 3	64.845
	CNS0095601	Golden flower (diploid) 1	128.128
	CNS0095602	Golden flower (diploid) 2	84.076
	CNS0095603	Golden flower (diploid) 3	78.821
	CNS0095604	Slightly white alabastrum(tetraploid) 1	207.202
	CNS0095605	Slightly white alabastrum(tetraploid) 2	222.167
	CNS0095606	Slightly white alabastrum(tetraploid) 3	275.273
	CNS0095607	Whole white alabastrum(tetraploid) 1	103.596
	CNS0095608	Whole white alabastrum(tetraploid) 2	151.995
	CNS0095609	Whole white alabastrum(tetraploid) 3	215.641
	CNS0095610	Silvery flower (tetraploid) 1	80.310
	CNS0095611	Silvery flower (tetraploid) 2	89.943
	CNS0095612	Silvery flower (tetraploid) 3	64.350
	CNS0095613	Golden flower (tetraploid) 1	55.527
	CNS0095614	Golden flower (tetraploid) 2	58.521
	CNS0095615	Golden flower (tetraploid) 3	18.407
CRA001975	CRR073297	Stem 1	199.546
	CRR073298	Stem 2	164.002
	CRR073299	Stem 3	237.357
	CRR073300	Leaf 1	95.038
	CRR073301	Leaf 2	136.401
	CRR073302	Leaf 3	117.902
	CRR073303	Juvenile bud 1	114.242
	CRR073304	Juvenile bud 2	107.323
	CRR073305	Juvenile bud 3	86.086
	CRR073306	Third green 1	45.204
	CRR073307	Third green 2	40.456
	CRR073308	Third green 3	36.323
	CRR073309	Second white 1	26.789
	CRR073310	Second white 2	33.455
	CRR073311	Second white 3	21.274
	CRR073312	Silver flowering 1	17.396
	CRR073313	Silver flowering 2	11.367
	CRR073314	Silver flowering 3	21.093
	CRR073315	Gold flowering 1	1936.439
	CRR073316	Gold flowering 2	1819.283
	CRR073317	Gold flowering 3	1240.783
	CRR073318	Tawny withering 1	150.267
	CRR073319	Tawny withering 2	200.086
	CRR073320	Tawny withering 3	134.407