Gene detail

Detail information of GWHGAAZE016108

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008785787.1	1.3706E-83	PREDICTED: glycine-rich RNA-binding protein [Phoenix dactylifera]
Swissprot	tr\|Q9LIN3\|RZ1A_ARATH	9E-69	Glycine-rich RNA-binding protein RZ1A {ECO:0000305}
trEMBL	tr\|A0A067KMU6\|A0A067KMU6_JATCU	7E-77	Uncharacterized protein {ECO:0000313\|EMBL:KDP37561.1}
TAIR10	AT3G26420.1	2E-28	RNA-binding (RRM/RBD/RNP motifs) family protein with retrovirus zinc finger-like domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	69382195	69383968	+
GWHAAZE00000004	mRNA	69382195	69383968	+
GWHAAZE00000004	exon	69382195	69382305	+
GWHAAZE00000004	exon	69383420	69383968	+
GWHAAZE00000004	CDS	69382195	69382305	+
GWHAAZE00000004	CDS	69383420	69383968	+

Transcript Sequence
>GWHTAAZE016128 ATGATTGAGCAGGAAGAATACCGTTGTTTCATTGGGAACCTTTCATGGTCAACATCTGACAGAGACTTGAAAGAAGCATTTAAAAAATTTGGCCGCCTTCTTGAGGCAAAGGTTGTCATGGACAGGTCATCTGGTCGCTCTCGTGGGTTTGGATTTGTTTCTTTTGACGAGGAGAAAGCGATGGAAGATGCAATTGAAGCAATGAATGGTATAGATTTAGACGGCCGGCCTATTTCAGTTGACAAAGCTCAGCCAAATCAGGGTTCCAGTCGAGATCGGGATGGGGACCGTGATGGAGGAGGCCGTGACCGATACCGGGGCCGTGATAGTGATCGGGACCGTGGCCGTGATTATGGAGGTGGTGGACGAGGAGGATCTGGTGGTGGAGACTGCTTCAGATGTGGAAAGCCTGGGCATTTTGCTAGGGAATGTCCATCTGGAGAGGGGTCGAGGGGAGGAGGAGGGGGCAGTAGGTATAGTGGGAGGGATGATAGATATGGAGGTGGAAGTGGTGGTGGCAGTCGCTATGGACCCGATCGTAATGGGGATCGCTTTGGTGGTCGCAGGGATTCTGGTAGTCGTGGAGGATCTGGAAACGATAGATATAGCCGTGATCGGTCTGGCCCATATGACCGTCCTGGAGGAGGAAGCTTTCGTTAA

Network for GWHGAAZE016108

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0194

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	10	78	8.10E-22
PF00098.24	zf-CCHC	131	146	1.70E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12885	RBMX, HNRNPG	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	36.583
	SRR3591706	second leaf	20.378
	SRR3591707	mature leaf	20.581
	SRR3591708	Shoot apex	38.012
	SRR3591709	Stem	30.020
	SRR3591710	White floral bud	39.024
	SRR3591711	White flower	41.592
	SRR3591712	Green floral bud	37.655
	SRR3591713	Yellow flower	31.442
SRP173429	SRR8316895	Juvenile bud stage	30.932
	SRR8316896	Juvenile bud stage	37.654
	SRR8316897	Juvenile bud stage	17.183
	SRR8316894	Third green stage	16.577
	SRR8316900	Third green stage	51.667
	SRR8316901	Third green stage	52.472
	SRR8316898	Complete white stage	25.905
	SRR8316899	Complete white stage	62.727
	SRR8316903	Complete white stage	39.826
	SRR8316902	Silver flowering stage	19.763
	SRR8316904	Silver flowering stage	26.299
	SRR8316905	Silver flowering stage	15.784
	SRR8316906	Gold flowering stage	43.365
	SRR8316907	Gold flowering stage	45.899
	SRR8316908	Gold flowering stage	40.272
SRP132670	SRR6706286	Control	68.053
	SRR6706287	Light intensity 50%	66.553
	SRR6706288	Light intensity 20%	66.755
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.304
	CNS0095593	Slightly white alabastrum(diploid) 2	39.895
	CNS0095594	Slightly white alabastrum(diploid) 3	32.319
	CNS0095595	Whole white alabastrum(diploid) 2	33.616
	CNS0095596	Whole white alabastrum(diploid) 3	37.148
	CNS0095597	Whole white alabastrum(diploid) 4	30.910
	CNS0095598	Silvery flower (diploied) 1	50.208
	CNS0095599	Silvery flower (diploied) 2	41.630
	CNS0095600	Silvery flower (diploied) 3	44.673
	CNS0095601	Golden flower (diploid) 1	42.795
	CNS0095602	Golden flower (diploid) 2	48.164
	CNS0095603	Golden flower (diploid) 3	44.589
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.372
	CNS0095605	Slightly white alabastrum(tetraploid) 2	48.154
	CNS0095606	Slightly white alabastrum(tetraploid) 3	83.165
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.738
	CNS0095608	Whole white alabastrum(tetraploid) 2	27.375
	CNS0095609	Whole white alabastrum(tetraploid) 3	56.521
	CNS0095610	Silvery flower (tetraploid) 1	66.636
	CNS0095611	Silvery flower (tetraploid) 2	53.438
	CNS0095612	Silvery flower (tetraploid) 3	53.886
	CNS0095613	Golden flower (tetraploid) 1	39.942
	CNS0095614	Golden flower (tetraploid) 2	62.092
	CNS0095615	Golden flower (tetraploid) 3	28.445
CRA001975	CRR073297	Stem 1	37.047
	CRR073298	Stem 2	38.998
	CRR073299	Stem 3	60.335
	CRR073300	Leaf 1	50.178
	CRR073301	Leaf 2	40.626
	CRR073302	Leaf 3	49.300
	CRR073303	Juvenile bud 1	48.525
	CRR073304	Juvenile bud 2	44.147
	CRR073305	Juvenile bud 3	55.453
	CRR073306	Third green 1	23.109
	CRR073307	Third green 2	21.201
	CRR073308	Third green 3	25.489
	CRR073309	Second white 1	19.699
	CRR073310	Second white 2	20.667
	CRR073311	Second white 3	16.311
	CRR073312	Silver flowering 1	16.454
	CRR073313	Silver flowering 2	20.881
	CRR073314	Silver flowering 3	13.998
	CRR073315	Gold flowering 1	13.991
	CRR073316	Gold flowering 2	15.712
	CRR073317	Gold flowering 3	19.708
	CRR073318	Tawny withering 1	28.410
	CRR073319	Tawny withering 2	30.653
	CRR073320	Tawny withering 3	25.927