Gene detail

Detail information of GWHGAAZE016190

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP35202.1	3.43472E-72	hypothetical protein JCGZ_09361 [Jatropha curcas]
Swissprot	tr\|O49884\|RL30_LUPLU	8E-73	60S ribosomal protein L30
trEMBL	tr\|A0A067KGI4\|A0A067KGI4_JATCU	1E-72	Uncharacterized protein {ECO:0000313\|EMBL:KDP35202.1}
TAIR10	AT1G36240.1	7E-55	Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	71264983	71267943	-
GWHAAZE00000004	mRNA	71264983	71267943	-
GWHAAZE00000004	exon	71267923	71267943	-
GWHAAZE00000004	exon	71267705	71267810	-
GWHAAZE00000004	exon	71267010	71267111	-
GWHAAZE00000004	exon	71265414	71265482	-
GWHAAZE00000004	exon	71264983	71265315	-
GWHAAZE00000004	CDS	71267923	71267943	-
GWHAAZE00000004	CDS	71267705	71267810	-
GWHAAZE00000004	CDS	71267010	71267111	-
GWHAAZE00000004	CDS	71265414	71265482	-
GWHAAZE00000004	CDS	71265275	71265315	-
GWHAAZE00000004	three_prime_UTR	71264983	71265274	-

Transcript Sequence
>GWHTAAZE016210 ATGGTGTCTGGGAAGAAAACCAAAAAGACTCATGAGAGTATTAACAACAGGCTCGCTCTTGTGATGAAGAGTGGCAAATATACACTTGGTTTCAAAACTGTTCTCGAGTCTCTTAGGAGCTCCAAAGGTAAGTTGATTATAATTTCCAATAATTGCCCGCCTCTGCGAAAATCTGAGATCGAGTACTACGCAATGCTTGCAAAGGTTGGAGTTCACCATTACAATGGAAACAATGTTGATCTAGGGACAGCGTGTGGCAAATATTTCCGTGTGTCGTGCCTTAGCATTGTTGATCCAGGTGATTCTGATATCATCAAGAGTCTGCCCGGAGATAATTAGAGGGGCCTTGGTCTGATAACTCTTATCATTCTGTTTTCTTGTATTCTGTGGATGTTAACATTAAAACCTTTCGGGTTTCTTGAGAATTTAAAGCCTGTCATTTATATATCCCCAATTATTGTTTTGGTTGATGAGGATGCATGTGATATATATATGTGAGGCCTTATTTTGAGCTGTTCTTGAAGCTGAATATTTCTTTTGTGTAATTTTCCGCACATTGTTCACTTTTTTTACCTTAAATAGAGACGATTTGTATTTAAATGCAAATACAGAGGTACAAACATTCCCAAAA

Network for GWHGAAZE016190

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01248.27	Ribosomal_L7Ae	13	105	3.60E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02908	RP-L30e, RPL30	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0022625	cellular_component	cytosolic large ribosomal subunit
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	111.242
	SRR3591706	second leaf	32.235
	SRR3591707	mature leaf	13.587
	SRR3591708	Shoot apex	107.736
	SRR3591709	Stem	38.143
	SRR3591710	White floral bud	47.577
	SRR3591711	White flower	45.784
	SRR3591712	Green floral bud	79.193
	SRR3591713	Yellow flower	33.164
SRP173429	SRR8316895	Juvenile bud stage	63.151
	SRR8316896	Juvenile bud stage	90.997
	SRR8316897	Juvenile bud stage	62.487
	SRR8316894	Third green stage	37.422
	SRR8316900	Third green stage	115.507
	SRR8316901	Third green stage	104.115
	SRR8316898	Complete white stage	25.006
	SRR8316899	Complete white stage	72.520
	SRR8316903	Complete white stage	31.205
	SRR8316902	Silver flowering stage	28.615
	SRR8316904	Silver flowering stage	37.362
	SRR8316905	Silver flowering stage	18.079
	SRR8316906	Gold flowering stage	42.089
	SRR8316907	Gold flowering stage	55.349
	SRR8316908	Gold flowering stage	67.352
SRP132670	SRR6706286	Control	51.086
	SRR6706287	Light intensity 50%	51.686
	SRR6706288	Light intensity 20%	56.863
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	127.160
	CNS0095593	Slightly white alabastrum(diploid) 2	134.374
	CNS0095594	Slightly white alabastrum(diploid) 3	121.336
	CNS0095595	Whole white alabastrum(diploid) 2	124.596
	CNS0095596	Whole white alabastrum(diploid) 3	149.414
	CNS0095597	Whole white alabastrum(diploid) 4	109.187
	CNS0095598	Silvery flower (diploied) 1	59.793
	CNS0095599	Silvery flower (diploied) 2	56.348
	CNS0095600	Silvery flower (diploied) 3	48.018
	CNS0095601	Golden flower (diploid) 1	49.847
	CNS0095602	Golden flower (diploid) 2	42.090
	CNS0095603	Golden flower (diploid) 3	41.973
	CNS0095604	Slightly white alabastrum(tetraploid) 1	116.085
	CNS0095605	Slightly white alabastrum(tetraploid) 2	112.081
	CNS0095606	Slightly white alabastrum(tetraploid) 3	102.736
	CNS0095607	Whole white alabastrum(tetraploid) 1	105.005
	CNS0095608	Whole white alabastrum(tetraploid) 2	94.641
	CNS0095609	Whole white alabastrum(tetraploid) 3	87.603
	CNS0095610	Silvery flower (tetraploid) 1	55.377
	CNS0095611	Silvery flower (tetraploid) 2	54.809
	CNS0095612	Silvery flower (tetraploid) 3	47.389
	CNS0095613	Golden flower (tetraploid) 1	45.070
	CNS0095614	Golden flower (tetraploid) 2	47.798
	CNS0095615	Golden flower (tetraploid) 3	28.278
CRA001975	CRR073297	Stem 1	48.184
	CRR073298	Stem 2	48.201
	CRR073299	Stem 3	44.893
	CRR073300	Leaf 1	46.593
	CRR073301	Leaf 2	45.855
	CRR073302	Leaf 3	65.653
	CRR073303	Juvenile bud 1	57.190
	CRR073304	Juvenile bud 2	34.652
	CRR073305	Juvenile bud 3	39.078
	CRR073306	Third green 1	18.563
	CRR073307	Third green 2	23.763
	CRR073308	Third green 3	14.783
	CRR073309	Second white 1	33.392
	CRR073310	Second white 2	23.807
	CRR073311	Second white 3	11.488
	CRR073312	Silver flowering 1	22.793
	CRR073313	Silver flowering 2	29.470
	CRR073314	Silver flowering 3	14.716
	CRR073315	Gold flowering 1	30.302
	CRR073316	Gold flowering 2	28.353
	CRR073317	Gold flowering 3	26.921
	CRR073318	Tawny withering 1	49.508
	CRR073319	Tawny withering 2	37.496
	CRR073320	Tawny withering 3	59.198