Gene detail

Detail information of GWHGAAZE016233

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO80914.1	1.3493E-122	hypothetical protein CISIN_1g004054mg [Citrus sinensis]
Swissprot	tr\|Q9SGZ5\|BXL7_ARATH	8E-114	Probable beta-D-xylosidase 7 (Precursor)
trEMBL	tr\|A0A067GMQ1\|A0A067GMQ1_CITSI	5E-123	Uncharacterized protein {ECO:0000313\|EMBL:KDO80914.1}
TAIR10	AT1G78060.1	3E-95	Glycosyl hydrolase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	72009659	72011797	-
GWHAAZE00000004	mRNA	72009659	72011797	-
GWHAAZE00000004	exon	72009659	72009991	-
GWHAAZE00000004	exon	72011408	72011797	-
GWHAAZE00000004	CDS	72011408	72011797	-
GWHAAZE00000004	CDS	72009659	72009991	-

Transcript Sequence
>GWHTAAZE016253 ATGTCATTCCTCCACACCTTAATCCCCCTCATAACCTTTCTCTTCACCCTAACCTCATCAACTCAGCCCCCATACTCATGCGATTCATCAAATCCCCACACCAAATCCCTCCCATTCTGTAACCCTAACCTCCCCATTCCTGTACGAGCCCGAGACCTCGTCAGCCGCCTCACGCTCGACGAGAAAGTTTCTCAGCTAGTTAACACCGCGCCGGCGATTCCCCGGCTCGATATCCCGGCCTACGAGTGGTGGTCCGAGGCCTTGCACGGCGTAGCCGATGCCGGCTACGGCGTTGAATTTAACGGCCGGATCAAGAATGCCACGAGTTTCCCTCAAGTCATTCTTACAGCCGCTTCGTTTGATTCGAAGCTTTGGTATCGTATTGGTCAGGTGATTGGAAAGGAGGCAAGAGCAGTGTACAATGAAGGGCAAACAAAGGGGATGACATTCTGGGCGCCAAACATAAATGTATTTAGGGACCCAAGATGGGGAAGAGGGCAAGAGACACCTGGTGAAGACCCGTTGGTCACCGGCAAATATGCAGTTTCCTATGTGAGAGGGATTCAAGGTGATGTGTTTGAAGGTGGGAAGCTCTTCACCAATGGCCCTCTTCAGGCCTCTGCTTGCTGCAAGCATTTCACTGCCTATGATTTGGATCATTGGAAAGGCATTAATCGCTTTGAATTTGATGCTAAGGTCAGTTCTCTGTGCTCACGTCTTTAA

Network for GWHGAAZE016233

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0297

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00933.22	Glyco_hydro_3	102	216	1.30E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.117
	SRR3591706	second leaf	12.461
	SRR3591707	mature leaf	1.726
	SRR3591708	Shoot apex	13.090
	SRR3591709	Stem	5.686
	SRR3591710	White floral bud	2.376
	SRR3591711	White flower	2.898
	SRR3591712	Green floral bud	1.447
	SRR3591713	Yellow flower	0.178
SRP173429	SRR8316895	Juvenile bud stage	3.272
	SRR8316896	Juvenile bud stage	3.330
	SRR8316897	Juvenile bud stage	1.733
	SRR8316894	Third green stage	1.536
	SRR8316900	Third green stage	1.250
	SRR8316901	Third green stage	1.509
	SRR8316898	Complete white stage	0.076
	SRR8316899	Complete white stage	1.469
	SRR8316903	Complete white stage	0.283
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.098
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.010
	SRR8316908	Gold flowering stage	0.177
SRP132670	SRR6706286	Control	2.066
	SRR6706287	Light intensity 50%	2.668
	SRR6706288	Light intensity 20%	2.249
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.144
	CNS0095593	Slightly white alabastrum(diploid) 2	1.768
	CNS0095594	Slightly white alabastrum(diploid) 3	0.813
	CNS0095595	Whole white alabastrum(diploid) 2	1.243
	CNS0095596	Whole white alabastrum(diploid) 3	0.498
	CNS0095597	Whole white alabastrum(diploid) 4	0.668
	CNS0095598	Silvery flower (diploied) 1	3.875
	CNS0095599	Silvery flower (diploied) 2	4.000
	CNS0095600	Silvery flower (diploied) 3	1.062
	CNS0095601	Golden flower (diploid) 1	1.726
	CNS0095602	Golden flower (diploid) 2	1.617
	CNS0095603	Golden flower (diploid) 3	1.066
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.386
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.273
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.977
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.016
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.343
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.497
	CNS0095610	Silvery flower (tetraploid) 1	0.500
	CNS0095611	Silvery flower (tetraploid) 2	1.372
	CNS0095612	Silvery flower (tetraploid) 3	0.811
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.123
	CNS0095615	Golden flower (tetraploid) 3	0.167
CRA001975	CRR073297	Stem 1	10.119
	CRR073298	Stem 2	7.495
	CRR073299	Stem 3	10.531
	CRR073300	Leaf 1	3.903
	CRR073301	Leaf 2	4.780
	CRR073302	Leaf 3	4.084
	CRR073303	Juvenile bud 1	2.216
	CRR073304	Juvenile bud 2	0.417
	CRR073305	Juvenile bud 3	3.522
	CRR073306	Third green 1	0.106
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.070
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.002
	CRR073315	Gold flowering 1	1.150
	CRR073316	Gold flowering 2	2.035
	CRR073317	Gold flowering 3	2.161
	CRR073318	Tawny withering 1	4.587
	CRR073319	Tawny withering 2	2.640
	CRR073320	Tawny withering 3	7.178