Gene detail

Detail information of GWHGAAZE016374

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010265853.1	7.9488E-22	PREDICTED: squamosa promoter-binding-like protein 14 [Nelumbo nucifera]
Swissprot	tr\|A3C057\|SPL17_ORYSJ	4E-14	Squamosa promoter-binding-like protein 17
trEMBL	tr\|D6QZ29\|D6QZ29_VITVI	4E-22	Promoter-binding protein SPL9 {ECO:0000313\|EMBL:ADG36380.1}
TAIR10	AT2G42200.1	2E-11	squamosa promoter binding protein-like 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	75172179	75173171	+
GWHAAZE00000004	mRNA	75172179	75173171	+
GWHAAZE00000004	exon	75172179	75172186	+
GWHAAZE00000004	exon	75172979	75173171	+
GWHAAZE00000004	CDS	75172179	75172186	+
GWHAAZE00000004	CDS	75172979	75173171	+

Transcript Sequence
>GWHTAAZE016394 ATGACGAGACGAAGGGCTGCCGCTACCGCCGCAAGTGAAGAGGGGGAGGGGGTACAGGGTGGGCAACCACCTAGGTGCCAGATGGAAGGGTGTAAAGTAGATCTAAGTGATGTTAATGCCTACTATTTAAGGTATAAAGTTTGTGGTATGCACTCAAAGTCACCTGTGGTTATCGTTGGTGACCTTGAGCAGAGGTTTTGA

Network for GWHGAAZE016374

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03110.15	SBP	26	66	4.10E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SBP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	3.048
	SRR3591707	mature leaf	0.982
	SRR3591708	Shoot apex	0.632
	SRR3591709	Stem	1.083
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.563
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	1.414
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.221
	SRR8316900	Third green stage	0.220
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.257
	SRR8316903	Complete white stage	0.286
	SRR8316902	Silver flowering stage	0.079
	SRR8316904	Silver flowering stage	0.197
	SRR8316905	Silver flowering stage	0.319
	SRR8316906	Gold flowering stage	0.113
	SRR8316907	Gold flowering stage	0.718
	SRR8316908	Gold flowering stage	0.149
SRP132670	SRR6706286	Control	0.083
	SRR6706287	Light intensity 50%	0.302
	SRR6706288	Light intensity 20%	0.154
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.102
	CNS0095593	Slightly white alabastrum(diploid) 2	0.201
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.900
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.674
	CNS0095599	Silvery flower (diploied) 2	1.984
	CNS0095600	Silvery flower (diploied) 3	0.826
	CNS0095601	Golden flower (diploid) 1	0.277
	CNS0095602	Golden flower (diploid) 2	0.030
	CNS0095603	Golden flower (diploid) 3	0.151
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.871
	CNS0095611	Silvery flower (tetraploid) 2	0.909
	CNS0095612	Silvery flower (tetraploid) 3	0.347
	CNS0095613	Golden flower (tetraploid) 1	1.186
	CNS0095614	Golden flower (tetraploid) 2	0.878
	CNS0095615	Golden flower (tetraploid) 3	1.240
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.202
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.431
	CRR073304	Juvenile bud 2	0.341
	CRR073305	Juvenile bud 3	0.757
	CRR073306	Third green 1	0.990
	CRR073307	Third green 2	1.346
	CRR073308	Third green 3	2.314
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.243
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	1.012
	CRR073313	Silver flowering 2	0.027
	CRR073314	Silver flowering 3	0.915
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.434
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000