Gene detail

Detail information of GWHGAAZE016409

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010092590.1	6.31655E-69	hypothetical protein L484_000182 [Morus notabilis]
Swissprot	tr\|Q9SZE8\|LBD39_ARATH	2E-60	LOB domain-containing protein 39
trEMBL	tr\|W9SE37\|W9SE37_9ROSA	2E-69	Uncharacterized protein {ECO:0000313\|EMBL:EXC37886.1}
TAIR10	AT4G37540.1	2E-49	LOB domain-containing protein 39

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	75983816	75984713	+
GWHAAZE00000004	mRNA	75983816	75984713	+
GWHAAZE00000004	exon	75983816	75984028	+
GWHAAZE00000004	exon	75984220	75984713	+
GWHAAZE00000004	five_prime_UTR	75983816	75983844	+
GWHAAZE00000004	CDS	75983845	75984028	+
GWHAAZE00000004	CDS	75984220	75984602	+
GWHAAZE00000004	three_prime_UTR	75984603	75984713	+

Transcript Sequence
>GWHTAAZE016429 AACAAGTGAGCTTTTAGAGAGAGAGAAAAATGAGCTGCAATGGCTGTCGAGTGCTCCGAAAGGGCTGCAGTGAAACATGCGTCCTTAGGCCGTGTTTGGATTGGATCCAAAACCCCGATTCCCAAGCCCATGCCGTCCTCTTCGTCTCCAAGTTCTTCGGCCGCTCCGATCTTCTCGCCTTCATCTCCGCTGTTCCTCCTAACAAGAGGCCTGCTCTATTTCAATCTCTCTTATTCGAAGCGTGTGGCCGTACGGTGAATCCAGTGAACGGCGCAATTGGACTTCTCTCCACTGGCAACTGGCACGTGTGCCAGGCTTCCGTCGAAACAGTCCTCGCCGGCGGCACTCTCCGTCCTCTTTCCGGTTCCGGAGTTCCTCCAGCCGACATCTACGAAGATTCCGAGTCCTTCAGGACCAGCACGATGAAGATCGGAAACCAGTATTCGAAGCAGTTGACCGTCGCCGGAAGAAGAGGAGGTGGCCGGAGTTTCCCGGTGGCTACGGCGTCGTTTAGCTCCGTCTTATCGAACAACTCGACGAGGTTTGGAATTGGGGAAGACGGTGAAGAGCCAAAATTACTGAACCTTTTTGTTTAGAAAAACTAAGTAATAATTAGAATTTAAGGAGGGAAAAGTGTGAATTTCTGTCTAACTTTTTTAGCGAGTACAGAAACTCAGTGAATCGGCGACTGTTGTAATAGAGGTCTT

Network for GWHGAAZE016409

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03195.15	LOB	2	101	1.10E-25

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	LOB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.626
	SRR3591706	second leaf	0.253
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.754
	SRR3591709	Stem	4.406
	SRR3591710	White floral bud	0.891
	SRR3591711	White flower	2.103
	SRR3591712	Green floral bud	1.179
	SRR3591713	Yellow flower	0.166
SRP173429	SRR8316895	Juvenile bud stage	6.919
	SRR8316896	Juvenile bud stage	8.500
	SRR8316897	Juvenile bud stage	5.959
	SRR8316894	Third green stage	3.164
	SRR8316900	Third green stage	8.765
	SRR8316901	Third green stage	7.251
	SRR8316898	Complete white stage	1.579
	SRR8316899	Complete white stage	3.189
	SRR8316903	Complete white stage	1.992
	SRR8316902	Silver flowering stage	2.916
	SRR8316904	Silver flowering stage	0.655
	SRR8316905	Silver flowering stage	0.452
	SRR8316906	Gold flowering stage	0.353
	SRR8316907	Gold flowering stage	0.398
	SRR8316908	Gold flowering stage	0.143
SRP132670	SRR6706286	Control	10.869
	SRR6706287	Light intensity 50%	7.333
	SRR6706288	Light intensity 20%	6.211
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.919
	CNS0095593	Slightly white alabastrum(diploid) 2	23.103
	CNS0095594	Slightly white alabastrum(diploid) 3	22.000
	CNS0095595	Whole white alabastrum(diploid) 2	17.465
	CNS0095596	Whole white alabastrum(diploid) 3	18.934
	CNS0095597	Whole white alabastrum(diploid) 4	15.605
	CNS0095598	Silvery flower (diploied) 1	4.800
	CNS0095599	Silvery flower (diploied) 2	4.636
	CNS0095600	Silvery flower (diploied) 3	3.009
	CNS0095601	Golden flower (diploid) 1	12.319
	CNS0095602	Golden flower (diploid) 2	4.613
	CNS0095603	Golden flower (diploid) 3	5.265
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.476
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.357
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.177
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.635
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.551
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.103
	CNS0095610	Silvery flower (tetraploid) 1	0.534
	CNS0095611	Silvery flower (tetraploid) 2	2.728
	CNS0095612	Silvery flower (tetraploid) 3	0.491
	CNS0095613	Golden flower (tetraploid) 1	0.032
	CNS0095614	Golden flower (tetraploid) 2	1.849
	CNS0095615	Golden flower (tetraploid) 3	0.289
CRA001975	CRR073297	Stem 1	10.757
	CRR073298	Stem 2	8.153
	CRR073299	Stem 3	11.725
	CRR073300	Leaf 1	6.783
	CRR073301	Leaf 2	7.609
	CRR073302	Leaf 3	12.656
	CRR073303	Juvenile bud 1	7.225
	CRR073304	Juvenile bud 2	2.011
	CRR073305	Juvenile bud 3	5.655
	CRR073306	Third green 1	9.901
	CRR073307	Third green 2	7.172
	CRR073308	Third green 3	11.191
	CRR073309	Second white 1	0.872
	CRR073310	Second white 2	0.231
	CRR073311	Second white 3	1.302
	CRR073312	Silver flowering 1	0.134
	CRR073313	Silver flowering 2	0.304
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.033
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.627
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.732