Gene detail

Detail information of GWHGAAZE016510

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007204038.1	2.15962E-21	hypothetical protein PRUPE_ppa020841mg [Prunus persica]
Swissprot	tr\|Q9ZQA8\|PABP7_ARATH	2E-16	Polyadenylate-binding protein 7
trEMBL	tr\|M5VV22\|M5VV22_PRUPE	8E-22	Uncharacterized protein {ECO:0000313\|EMBL:EMJ05237.1}
TAIR10	AT2G36660.1	1E-14	poly(A) binding protein 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	77936266	77936995	-
GWHAAZE00000004	mRNA	77936266	77936995	-
GWHAAZE00000004	exon	77936266	77936354	-
GWHAAZE00000004	exon	77936446	77936522	-
GWHAAZE00000004	exon	77936776	77936856	-
GWHAAZE00000004	exon	77936958	77936995	-
GWHAAZE00000004	CDS	77936958	77936995	-
GWHAAZE00000004	CDS	77936776	77936856	-
GWHAAZE00000004	CDS	77936446	77936522	-
GWHAAZE00000004	CDS	77936266	77936354	-

Transcript Sequence
>GWHTAAZE016530 ATGGGAGAAAAAGTGGAGTTGGCAAACTGTTTGTCAAGCTTCGTCCAGTTTGTTTATGATGAATCAGTGAATTCTGCTATTGAGAAACTTAATGGCAGCATTGTTAATGGGAAACAAATAGGTTTTAGATTTGTTAACTTCGAGAACCCAGATGATGCAAGGAAGGCAATGGAGACTATGAATGGATTGCAACTTGGATTGAAGATGATGTATGTAGCTAGGGCACAAAAGAATGTTGAGCGAGAGCAAATCTTGCGGCGTCAGTTTGAGGACCAAAGGAAGTAG

Network for GWHGAAZE016510

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0055

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	41	67	2.30E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13126	PABPC	RNA transport	map03013
		mRNA surveillance pathway	map03015
		RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.922
	SRR8316897	Juvenile bud stage	0.536
	SRR8316894	Third green stage	0.274
	SRR8316900	Third green stage	0.136
	SRR8316901	Third green stage	0.007
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.006
	SRR6706287	Light intensity 50%	0.104
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.513
	CNS0095593	Slightly white alabastrum(diploid) 2	0.846
	CNS0095594	Slightly white alabastrum(diploid) 3	1.100
	CNS0095595	Whole white alabastrum(diploid) 2	1.040
	CNS0095596	Whole white alabastrum(diploid) 3	0.364
	CNS0095597	Whole white alabastrum(diploid) 4	0.052
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.078
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.374
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.242
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.499
	CRR073298	Stem 2	0.320
	CRR073299	Stem 3	0.210
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000