Gene detail

Detail information of GWHGAAZE016528

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010106049.1	7.71591E-65	putative calcium-binding protein CML41 [Morus notabilis]
Swissprot	tr\|Q8L3R2\|CML41_ARATH	8E-51	Probable calcium-binding protein CML41
trEMBL	tr\|W9S3N7\|W9S3N7_9ROSA	3E-65	Putative calcium-binding protein CML41 {ECO:0000313\|EMBL:EXC07319.1}
TAIR10	AT3G50770.1	1E-39	calmodulin-like 41

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	78281730	78282281	-
GWHAAZE00000004	mRNA	78281730	78282281	-
GWHAAZE00000004	exon	78281730	78282281	-
GWHAAZE00000004	CDS	78281730	78282281	-

Transcript Sequence
>GWHTAAZE016548 ATGAAAACTCTAGACATTAATATTCCCAAGCCATCCAAATGGTTCTCTCTTTCTCATCTCCGGTCAAAGCCCAAATCTCCAACCCCTCCTCTCTCTCCTTCTCGGCCTAAAACCGCCACCAAAGAAGCCGATTACCAAGATGTTTTCCACTTCTTCGACAAAAATGGTGATGGAAAAATTTCAACCCAAGAACTTATTACTTATTTTCGATCCATAGGCGACTCTGTATCCCAAAGCGAAGCTCAGAGGGTGATAAGTGAGTTTGATGTCGATGGTGATAATTTACTAGACTTTGAAGACTTTGTTAAGTTGATGGAGAGAGATAAAGAAGAAGGTGGTAGCGGTGAAGACGATCATGATCTCAAAAGGGCTTTTGAGATGTTTGAGGATGAGAAAGGGTCTGGGTGCATCACACCAAAGGGGTTGCAACAAGTTTTGAATCTACTTGGAGATGAGAAGTCTTACGAGGAGTGTGAGGCTATGATTAAGGTTTTTGATGTTGATGGAAATGGAGTTCTCGATTTTCATGAGTTTCATAAGATGATGGCATGA

Network for GWHGAAZE016528

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	45	106	3.30E-12
PF13833.7	EF-hand_8	134	182	4.80E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.255
	SRR3591706	second leaf	3.210
	SRR3591707	mature leaf	2.379
	SRR3591708	Shoot apex	1.854
	SRR3591709	Stem	15.475
	SRR3591710	White floral bud	2.258
	SRR3591711	White flower	3.267
	SRR3591712	Green floral bud	2.712
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	5.826
	SRR8316896	Juvenile bud stage	4.343
	SRR8316897	Juvenile bud stage	4.588
	SRR8316894	Third green stage	2.136
	SRR8316900	Third green stage	7.468
	SRR8316901	Third green stage	5.625
	SRR8316898	Complete white stage	3.175
	SRR8316899	Complete white stage	5.918
	SRR8316903	Complete white stage	6.489
	SRR8316902	Silver flowering stage	2.322
	SRR8316904	Silver flowering stage	3.242
	SRR8316905	Silver flowering stage	0.327
	SRR8316906	Gold flowering stage	1.847
	SRR8316907	Gold flowering stage	5.756
	SRR8316908	Gold flowering stage	7.049
SRP132670	SRR6706286	Control	2.329
	SRR6706287	Light intensity 50%	2.090
	SRR6706288	Light intensity 20%	1.997
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.431
	CNS0095593	Slightly white alabastrum(diploid) 2	8.053
	CNS0095594	Slightly white alabastrum(diploid) 3	7.156
	CNS0095595	Whole white alabastrum(diploid) 2	6.079
	CNS0095596	Whole white alabastrum(diploid) 3	6.944
	CNS0095597	Whole white alabastrum(diploid) 4	5.228
	CNS0095598	Silvery flower (diploied) 1	5.578
	CNS0095599	Silvery flower (diploied) 2	4.220
	CNS0095600	Silvery flower (diploied) 3	1.278
	CNS0095601	Golden flower (diploid) 1	2.227
	CNS0095602	Golden flower (diploid) 2	2.373
	CNS0095603	Golden flower (diploid) 3	1.899
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.956
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.702
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.690
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.856
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.492
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.053
	CNS0095610	Silvery flower (tetraploid) 1	1.651
	CNS0095611	Silvery flower (tetraploid) 2	2.506
	CNS0095612	Silvery flower (tetraploid) 3	1.366
	CNS0095613	Golden flower (tetraploid) 1	0.680
	CNS0095614	Golden flower (tetraploid) 2	1.074
	CNS0095615	Golden flower (tetraploid) 3	0.064
CRA001975	CRR073297	Stem 1	2.675
	CRR073298	Stem 2	2.338
	CRR073299	Stem 3	6.517
	CRR073300	Leaf 1	0.761
	CRR073301	Leaf 2	1.075
	CRR073302	Leaf 3	2.673
	CRR073303	Juvenile bud 1	2.160
	CRR073304	Juvenile bud 2	1.116
	CRR073305	Juvenile bud 3	2.329
	CRR073306	Third green 1	0.642
	CRR073307	Third green 2	0.275
	CRR073308	Third green 3	0.241
	CRR073309	Second white 1	0.034
	CRR073310	Second white 2	0.153
	CRR073311	Second white 3	0.717
	CRR073312	Silver flowering 1	0.034
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.326
	CRR073315	Gold flowering 1	1.148
	CRR073316	Gold flowering 2	0.504
	CRR073317	Gold flowering 3	0.337
	CRR073318	Tawny withering 1	12.346
	CRR073319	Tawny withering 2	12.349
	CRR073320	Tawny withering 3	26.597