Gene detail

Detail information of GWHGAAZE016532

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP07560.1	4.4953E-120	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SDY5\|RCE1_ARATH	2E-107	NEDD8-conjugating enzyme Ubc12
trEMBL	tr\|A0A068UG64\|A0A068UG64_COFCA	2E-120	Coffea canephora DH200=94 genomic scaffold, scaffold_26 {ECO:0000313\|EMBL:CDP07560.1}
TAIR10	AT4G36800.2	2E-85	RUB1 conjugating enzyme 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	78324936	78326349	+
GWHAAZE00000004	mRNA	78324936	78326349	+
GWHAAZE00000004	exon	78324936	78325044	+
GWHAAZE00000004	exon	78325393	78325594	+
GWHAAZE00000004	exon	78325810	78325888	+
GWHAAZE00000004	exon	78325991	78326107	+
GWHAAZE00000004	exon	78326212	78326349	+
GWHAAZE00000004	CDS	78324936	78325044	+
GWHAAZE00000004	CDS	78325393	78325594	+
GWHAAZE00000004	CDS	78325810	78325888	+
GWHAAZE00000004	CDS	78325991	78326107	+
GWHAAZE00000004	CDS	78326212	78326349	+

Transcript Sequence
>GWHTAAZE016552 ATGATTAGATTATTCAAAGTAAAGGAGAAGCAGAGGGAACTTGCTGAAAATTCTAATGGGAAACCTCCTGTCAAGAAACAAAGTGCAGGAGAATTACGTCTTCATAGAGAAGGATCTGTCGTCTTTTCCATTCATTGCAACTTATTTCTCGGCAATTGTTATTATTGTTGTTGTTGTTATTACCATCGTTTTGGTTTTGTAGATATCAGTGAACTGAACCTTCCAAAGACATGTAGCATAGCATTCCCCAATGGCAAGGATGACCTAATGAACTTTGAAGTCACCATTCGGCCTGATGAAGGATATTATCTAGGCGGAATATTTTTATTTTCGTTCCAAATTTCTCCTATCTATCCTCACGAAGCACCAAAGGTCAAATGCAAGACTAAGGTTTATCATCCTAATATTGACTTGGAAGGAAATGTTTGCCTTAACATTCTACGAGAAGACTGGAAACCTGTCTTAAATATAAACACTATTATCTATGGCTTGTATCATCTGTTCACGGAGCCCAATCACGAGGATCCGCTTAATCCTGATGCTGCTGCAGTATTGAGAGATAACCCGAAGTTGTTTGAGTCCAATGTGAGAAGGGCAATGTCTGGCGGATACGTGGGGCAAACCTTCTTCACTCGATGCATATAG

Network for GWHGAAZE016532

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	76	199	9.60E-37

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10579	UBE2M, UBC12	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	88.220
	SRR3591706	second leaf	40.286
	SRR3591707	mature leaf	57.996
	SRR3591708	Shoot apex	62.171
	SRR3591709	Stem	111.002
	SRR3591710	White floral bud	82.975
	SRR3591711	White flower	71.891
	SRR3591712	Green floral bud	60.047
	SRR3591713	Yellow flower	94.248
SRP173429	SRR8316895	Juvenile bud stage	38.637
	SRR8316896	Juvenile bud stage	64.719
	SRR8316897	Juvenile bud stage	27.551
	SRR8316894	Third green stage	24.578
	SRR8316900	Third green stage	71.530
	SRR8316901	Third green stage	73.257
	SRR8316898	Complete white stage	60.193
	SRR8316899	Complete white stage	136.740
	SRR8316903	Complete white stage	91.777
	SRR8316902	Silver flowering stage	49.107
	SRR8316904	Silver flowering stage	71.842
	SRR8316905	Silver flowering stage	29.589
	SRR8316906	Gold flowering stage	108.652
	SRR8316907	Gold flowering stage	109.515
	SRR8316908	Gold flowering stage	99.075
SRP132670	SRR6706286	Control	47.057
	SRR6706287	Light intensity 50%	42.150
	SRR6706288	Light intensity 20%	43.282
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	66.374
	CNS0095593	Slightly white alabastrum(diploid) 2	62.295
	CNS0095594	Slightly white alabastrum(diploid) 3	67.357
	CNS0095595	Whole white alabastrum(diploid) 2	63.659
	CNS0095596	Whole white alabastrum(diploid) 3	58.108
	CNS0095597	Whole white alabastrum(diploid) 4	69.317
	CNS0095598	Silvery flower (diploied) 1	77.679
	CNS0095599	Silvery flower (diploied) 2	75.126
	CNS0095600	Silvery flower (diploied) 3	109.976
	CNS0095601	Golden flower (diploid) 1	92.843
	CNS0095602	Golden flower (diploid) 2	110.064
	CNS0095603	Golden flower (diploid) 3	110.371
	CNS0095604	Slightly white alabastrum(tetraploid) 1	63.344
	CNS0095605	Slightly white alabastrum(tetraploid) 2	60.592
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.833
	CNS0095607	Whole white alabastrum(tetraploid) 1	59.369
	CNS0095608	Whole white alabastrum(tetraploid) 2	60.653
	CNS0095609	Whole white alabastrum(tetraploid) 3	52.753
	CNS0095610	Silvery flower (tetraploid) 1	96.316
	CNS0095611	Silvery flower (tetraploid) 2	108.924
	CNS0095612	Silvery flower (tetraploid) 3	78.494
	CNS0095613	Golden flower (tetraploid) 1	86.261
	CNS0095614	Golden flower (tetraploid) 2	95.343
	CNS0095615	Golden flower (tetraploid) 3	124.927
CRA001975	CRR073297	Stem 1	31.622
	CRR073298	Stem 2	33.859
	CRR073299	Stem 3	27.567
	CRR073300	Leaf 1	35.128
	CRR073301	Leaf 2	40.415
	CRR073302	Leaf 3	24.800
	CRR073303	Juvenile bud 1	29.365
	CRR073304	Juvenile bud 2	27.878
	CRR073305	Juvenile bud 3	30.867
	CRR073306	Third green 1	17.510
	CRR073307	Third green 2	17.311
	CRR073308	Third green 3	15.020
	CRR073309	Second white 1	24.541
	CRR073310	Second white 2	29.776
	CRR073311	Second white 3	20.435
	CRR073312	Silver flowering 1	26.474
	CRR073313	Silver flowering 2	22.478
	CRR073314	Silver flowering 3	26.053
	CRR073315	Gold flowering 1	41.555
	CRR073316	Gold flowering 2	49.774
	CRR073317	Gold flowering 3	35.887
	CRR073318	Tawny withering 1	61.221
	CRR073319	Tawny withering 2	71.850
	CRR073320	Tawny withering 3	77.178