Gene detail

Detail information of GWHGAAZE016583

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004152663.1	9.2502E-109	PREDICTED: V-type proton ATPase 16 kDa proteolipid subunit-like [Cucumis sativus]
Swissprot	tr\|Q96473\|VATL_KALDA	1E-110	V-type proton ATPase 16 kDa proteolipid subunit
trEMBL	tr\|A0A067FUW1\|A0A067FUW1_CITSI	3E-109	Uncharacterized protein {ECO:0000313\|EMBL:KDO71128.1}
TAIR10	AT1G19910.1	2E-58	ATPase, F0/V0 complex, subunit C protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	79116223	79119956	+
GWHAAZE00000004	mRNA	79116223	79119956	+
GWHAAZE00000004	exon	79116223	79116301	+
GWHAAZE00000004	exon	79118205	79118490	+
GWHAAZE00000004	exon	79119824	79119956	+
GWHAAZE00000004	CDS	79116223	79116301	+
GWHAAZE00000004	CDS	79118205	79118490	+
GWHAAZE00000004	CDS	79119824	79119956	+

Transcript Sequence
>GWHTAAZE016603 ATGTCTTCGGCTTTTAGCGGCGATGAAACGGCACCGTTCTTCGGCTTCCTCGGCGCCGCAGCTGCCCTCGTCTTCTCCTGTATGGGGGCTGCTTATGGGACAGCGAAGAGCGGAGTTGGAGTGGCATCAATGGGTGTGATGAGGCCAGAGTTAGTGATGAAGTCAATTGTTCCGGTTGTTATGGCTGGAGTTTTGGGTATTTATGGATTGATTATTGCTGTTATCATTAGTACCGGAATTAATCCCAAAGCTAAGTCTTATTACCTATTTGATGGATATGCTCACCTTTCTTCTGGTCTTGCTTGTGGCCTCGCTGGTCTTTCTGCTGGTATGGCTATTGGTATTGTTGGTGATGCCGGTGTCAGAGCCAATGCACAACAACCTAAGCTTTTTGTCGGGATGATCCTCATTCTCATTTTCGCTGAAGCTTTGGCTCTCTATGGTCTTATTGTTGGTATCATCCTCTCTTCTCGAGCTGGTCAGTCCAGAGCAGACTAA

Network for GWHGAAZE016583

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	17	76	8.70E-14
PF00137.22	ATP-synt_C	97	155	2.60E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	839.259
	SRR3591706	second leaf	458.256
	SRR3591707	mature leaf	366.647
	SRR3591708	Shoot apex	576.271
	SRR3591709	Stem	544.022
	SRR3591710	White floral bud	745.394
	SRR3591711	White flower	538.464
	SRR3591712	Green floral bud	854.953
	SRR3591713	Yellow flower	463.539
SRP173429	SRR8316895	Juvenile bud stage	355.165
	SRR8316896	Juvenile bud stage	440.469
	SRR8316897	Juvenile bud stage	244.523
	SRR8316894	Third green stage	179.973
	SRR8316900	Third green stage	779.288
	SRR8316901	Third green stage	723.409
	SRR8316898	Complete white stage	394.768
	SRR8316899	Complete white stage	916.716
	SRR8316903	Complete white stage	485.640
	SRR8316902	Silver flowering stage	321.609
	SRR8316904	Silver flowering stage	372.319
	SRR8316905	Silver flowering stage	177.240
	SRR8316906	Gold flowering stage	526.625
	SRR8316907	Gold flowering stage	551.660
	SRR8316908	Gold flowering stage	541.089
SRP132670	SRR6706286	Control	445.615
	SRR6706287	Light intensity 50%	439.594
	SRR6706288	Light intensity 20%	489.517
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	655.138
	CNS0095593	Slightly white alabastrum(diploid) 2	778.469
	CNS0095594	Slightly white alabastrum(diploid) 3	607.067
	CNS0095595	Whole white alabastrum(diploid) 2	703.311
	CNS0095596	Whole white alabastrum(diploid) 3	768.443
	CNS0095597	Whole white alabastrum(diploid) 4	671.592
	CNS0095598	Silvery flower (diploied) 1	404.170
	CNS0095599	Silvery flower (diploied) 2	445.192
	CNS0095600	Silvery flower (diploied) 3	613.979
	CNS0095601	Golden flower (diploid) 1	424.151
	CNS0095602	Golden flower (diploid) 2	535.713
	CNS0095603	Golden flower (diploid) 3	488.620
	CNS0095604	Slightly white alabastrum(tetraploid) 1	826.838
	CNS0095605	Slightly white alabastrum(tetraploid) 2	813.932
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1041.513
	CNS0095607	Whole white alabastrum(tetraploid) 1	722.147
	CNS0095608	Whole white alabastrum(tetraploid) 2	795.503
	CNS0095609	Whole white alabastrum(tetraploid) 3	924.561
	CNS0095610	Silvery flower (tetraploid) 1	657.659
	CNS0095611	Silvery flower (tetraploid) 2	592.923
	CNS0095612	Silvery flower (tetraploid) 3	491.155
	CNS0095613	Golden flower (tetraploid) 1	472.867
	CNS0095614	Golden flower (tetraploid) 2	561.191
	CNS0095615	Golden flower (tetraploid) 3	461.299
CRA001975	CRR073297	Stem 1	372.539
	CRR073298	Stem 2	396.367
	CRR073299	Stem 3	511.468
	CRR073300	Leaf 1	484.053
	CRR073301	Leaf 2	482.414
	CRR073302	Leaf 3	662.233
	CRR073303	Juvenile bud 1	791.565
	CRR073304	Juvenile bud 2	711.810
	CRR073305	Juvenile bud 3	650.857
	CRR073306	Third green 1	463.811
	CRR073307	Third green 2	517.164
	CRR073308	Third green 3	455.634
	CRR073309	Second white 1	421.581
	CRR073310	Second white 2	277.511
	CRR073311	Second white 3	189.045
	CRR073312	Silver flowering 1	280.090
	CRR073313	Silver flowering 2	399.292
	CRR073314	Silver flowering 3	246.276
	CRR073315	Gold flowering 1	215.660
	CRR073316	Gold flowering 2	215.632
	CRR073317	Gold flowering 3	285.115
	CRR073318	Tawny withering 1	361.728
	CRR073319	Tawny withering 2	324.413
	CRR073320	Tawny withering 3	365.193