Gene detail

Detail information of GWHGAAZE016612

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010268697.1	5.14444E-87	PREDICTED: AP-2 complex subunit sigma-like isoform X1 [Nelumbo nucifera]
Swissprot	tr\|Q84WL9\|AP2S_ARATH	7E-87	AP-2 complex subunit sigma
trEMBL	tr\|A0A068UFZ7\|A0A068UFZ7_COFCA	4E-87	Coffea canephora DH200=94 genomic scaffold, scaffold_26 {ECO:0000313\|EMBL:CDP07401.1}
TAIR10	AT1G47830.1	2E-68	SNARE-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	79701347	79703016	+
GWHAAZE00000004	mRNA	79701347	79703016	+
GWHAAZE00000004	exon	79701347	79701445	+
GWHAAZE00000004	exon	79701541	79701591	+
GWHAAZE00000004	exon	79702317	79702490	+
GWHAAZE00000004	exon	79702918	79703016	+
GWHAAZE00000004	CDS	79701347	79701445	+
GWHAAZE00000004	CDS	79701541	79701591	+
GWHAAZE00000004	CDS	79702317	79702490	+
GWHAAZE00000004	CDS	79702918	79703016	+

Transcript Sequence
>GWHTAAZE016632 ATCCGGTTCATACTGCTTCAGAACAGGCAAGGCAAGACTCGTCTCGCCAAATATTACATTCCTCTCGAGGAATCCGAGAAACACAAGGTTGAGTACGAGGTTCATCGATTGGTTGTGAACAGAGATCCCAAGTTCACCAATTTCGTTGAGTTCCGTACTCACAAGGTTATCTACAGGCGATATGCTGGACTATTTTTCTCGATTTGTGTTGATATCACCGATAATGAGCTAGCATACTTGGAGTGCATCCACTTATTTGTCGAGATTTTGGATCACTTCTTCAGCAATGTTTGCGAGCTAGATTTGGTTTTTAATTTTCACAAGGTATATCTGATACTGGACGAGTTCATTCTTGCTGGGGAACTCCAAGAAACAAGCAAGAAGGTACTTTATTGTTCCAAATGCCCACACCCACACACATAA

Network for GWHGAAZE016612

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01217.21	Clat_adaptor_s	1	129	1.60E-50

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11827	AP2S1	Endocytosis	map04144
		Endocrine and other factor-regulated calcium reabsorption	map04961
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:0015031	biological_process	protein transport

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	48.967
	SRR3591706	second leaf	24.672
	SRR3591707	mature leaf	8.534
	SRR3591708	Shoot apex	42.378
	SRR3591709	Stem	24.319
	SRR3591710	White floral bud	30.300
	SRR3591711	White flower	23.756
	SRR3591712	Green floral bud	35.251
	SRR3591713	Yellow flower	21.022
SRP173429	SRR8316895	Juvenile bud stage	78.169
	SRR8316896	Juvenile bud stage	117.487
	SRR8316897	Juvenile bud stage	70.965
	SRR8316894	Third green stage	35.785
	SRR8316900	Third green stage	40.134
	SRR8316901	Third green stage	61.281
	SRR8316898	Complete white stage	9.302
	SRR8316899	Complete white stage	31.569
	SRR8316903	Complete white stage	15.205
	SRR8316902	Silver flowering stage	16.889
	SRR8316904	Silver flowering stage	15.529
	SRR8316905	Silver flowering stage	10.573
	SRR8316906	Gold flowering stage	41.757
	SRR8316907	Gold flowering stage	29.060
	SRR8316908	Gold flowering stage	39.126
SRP132670	SRR6706286	Control	13.526
	SRR6706287	Light intensity 50%	12.510
	SRR6706288	Light intensity 20%	15.522
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	81.038
	CNS0095593	Slightly white alabastrum(diploid) 2	52.646
	CNS0095594	Slightly white alabastrum(diploid) 3	87.384
	CNS0095595	Whole white alabastrum(diploid) 2	42.621
	CNS0095596	Whole white alabastrum(diploid) 3	42.244
	CNS0095597	Whole white alabastrum(diploid) 4	29.981
	CNS0095598	Silvery flower (diploied) 1	31.216
	CNS0095599	Silvery flower (diploied) 2	51.284
	CNS0095600	Silvery flower (diploied) 3	18.708
	CNS0095601	Golden flower (diploid) 1	24.217
	CNS0095602	Golden flower (diploid) 2	21.924
	CNS0095603	Golden flower (diploid) 3	21.727
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.009
	CNS0095605	Slightly white alabastrum(tetraploid) 2	31.193
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.193
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.427
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.833
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.796
	CNS0095610	Silvery flower (tetraploid) 1	6.891
	CNS0095611	Silvery flower (tetraploid) 2	6.556
	CNS0095612	Silvery flower (tetraploid) 3	3.685
	CNS0095613	Golden flower (tetraploid) 1	2.528
	CNS0095614	Golden flower (tetraploid) 2	5.594
	CNS0095615	Golden flower (tetraploid) 3	2.237
CRA001975	CRR073297	Stem 1	29.116
	CRR073298	Stem 2	23.391
	CRR073299	Stem 3	19.652
	CRR073300	Leaf 1	20.818
	CRR073301	Leaf 2	18.026
	CRR073302	Leaf 3	15.989
	CRR073303	Juvenile bud 1	10.426
	CRR073304	Juvenile bud 2	10.713
	CRR073305	Juvenile bud 3	5.694
	CRR073306	Third green 1	2.103
	CRR073307	Third green 2	1.867
	CRR073308	Third green 3	1.582
	CRR073309	Second white 1	4.441
	CRR073310	Second white 2	1.494
	CRR073311	Second white 3	1.213
	CRR073312	Silver flowering 1	1.297
	CRR073313	Silver flowering 2	1.059
	CRR073314	Silver flowering 3	1.945
	CRR073315	Gold flowering 1	9.956
	CRR073316	Gold flowering 2	18.567
	CRR073317	Gold flowering 3	7.183
	CRR073318	Tawny withering 1	18.123
	CRR073319	Tawny withering 2	28.427
	CRR073320	Tawny withering 3	19.688