Gene detail

Detail information of GWHGAAZE016799

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010655009.1	6.99171E-47	PREDICTED: 40S ribosomal protein S12 [Vitis vinifera]
Swissprot	tr\|Q9XHS0\|RS12_HORVU	1E-40	40S ribosomal protein S12
trEMBL	tr\|I1KVK9\|I1KVK9_SOYBN	3E-47	40S ribosomal protein S12 {ECO:0000256\|RuleBase:RU000670}
TAIR10	AT2G32060.3	2E-31	Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	83094629	83094877	+
GWHAAZE00000004	mRNA	83094629	83094877	+
GWHAAZE00000004	exon	83094629	83094877	+
GWHAAZE00000004	CDS	83094629	83094877	+

Transcript Sequence
>GWHTAAZE016819 ATGGACACAATGACAGCACTTCAGCTTGTGCTGAGGAAATCACTTGCTCATGGCGGGCTCGCTCGAGGTCTTCATGAAGGCGCCAAGGTGATCGAGAAGCATGCTGCCCAGCTTTGTGTGGTAGCAGAGGATTGCAACCAGCCCGATTATGTGAAGCTGGTTAAAGCGCTTTGTGCTGATCATAATGTCAGCTTGATAACAGTTCCTAGTGCTAAAACTCTTGGAGAGTGGTGTGGTGTAAGTACTTAA

Network for GWHGAAZE016799

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01248.27	Ribosomal_L7Ae	6	81	1.40E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02951	RP-S12e, RPS12	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	645.104
	SRR3591706	second leaf	225.313
	SRR3591707	mature leaf	81.447
	SRR3591708	Shoot apex	708.643
	SRR3591709	Stem	291.230
	SRR3591710	White floral bud	249.745
	SRR3591711	White flower	279.125
	SRR3591712	Green floral bud	418.906
	SRR3591713	Yellow flower	177.993
SRP173429	SRR8316895	Juvenile bud stage	243.176
	SRR8316896	Juvenile bud stage	311.910
	SRR8316897	Juvenile bud stage	155.290
	SRR8316894	Third green stage	130.872
	SRR8316900	Third green stage	469.266
	SRR8316901	Third green stage	446.940
	SRR8316898	Complete white stage	107.387
	SRR8316899	Complete white stage	458.644
	SRR8316903	Complete white stage	150.860
	SRR8316902	Silver flowering stage	95.865
	SRR8316904	Silver flowering stage	89.841
	SRR8316905	Silver flowering stage	47.878
	SRR8316906	Gold flowering stage	160.504
	SRR8316907	Gold flowering stage	165.155
	SRR8316908	Gold flowering stage	239.620
SRP132670	SRR6706286	Control	504.227
	SRR6706287	Light intensity 50%	465.909
	SRR6706288	Light intensity 20%	500.659
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	327.714
	CNS0095593	Slightly white alabastrum(diploid) 2	445.061
	CNS0095594	Slightly white alabastrum(diploid) 3	318.459
	CNS0095595	Whole white alabastrum(diploid) 2	312.095
	CNS0095596	Whole white alabastrum(diploid) 3	339.365
	CNS0095597	Whole white alabastrum(diploid) 4	211.772
	CNS0095598	Silvery flower (diploied) 1	215.926
	CNS0095599	Silvery flower (diploied) 2	183.029
	CNS0095600	Silvery flower (diploied) 3	171.678
	CNS0095601	Golden flower (diploid) 1	139.297
	CNS0095602	Golden flower (diploid) 2	136.938
	CNS0095603	Golden flower (diploid) 3	128.566
	CNS0095604	Slightly white alabastrum(tetraploid) 1	336.452
	CNS0095605	Slightly white alabastrum(tetraploid) 2	324.366
	CNS0095606	Slightly white alabastrum(tetraploid) 3	462.900
	CNS0095607	Whole white alabastrum(tetraploid) 1	165.592
	CNS0095608	Whole white alabastrum(tetraploid) 2	157.458
	CNS0095609	Whole white alabastrum(tetraploid) 3	339.088
	CNS0095610	Silvery flower (tetraploid) 1	155.769
	CNS0095611	Silvery flower (tetraploid) 2	163.571
	CNS0095612	Silvery flower (tetraploid) 3	166.449
	CNS0095613	Golden flower (tetraploid) 1	98.935
	CNS0095614	Golden flower (tetraploid) 2	139.831
	CNS0095615	Golden flower (tetraploid) 3	79.184
CRA001975	CRR073297	Stem 1	400.614
	CRR073298	Stem 2	415.184
	CRR073299	Stem 3	434.550
	CRR073300	Leaf 1	421.530
	CRR073301	Leaf 2	451.226
	CRR073302	Leaf 3	542.843
	CRR073303	Juvenile bud 1	460.764
	CRR073304	Juvenile bud 2	386.410
	CRR073305	Juvenile bud 3	426.133
	CRR073306	Third green 1	93.856
	CRR073307	Third green 2	112.467
	CRR073308	Third green 3	121.745
	CRR073309	Second white 1	106.110
	CRR073310	Second white 2	94.891
	CRR073311	Second white 3	53.685
	CRR073312	Silver flowering 1	86.033
	CRR073313	Silver flowering 2	146.896
	CRR073314	Silver flowering 3	81.506
	CRR073315	Gold flowering 1	212.716
	CRR073316	Gold flowering 2	199.043
	CRR073317	Gold flowering 3	193.327
	CRR073318	Tawny withering 1	512.827
	CRR073319	Tawny withering 2	400.957
	CRR073320	Tawny withering 3	537.869