Gene detail

Detail information of GWHGAAZE016804

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011097032.1	1.94953E-37	PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At5g63710 [Sesamum indicum]
Swissprot	tr\|Q8W4S5\|Y5371_ARATH	2E-19	Probable LRR receptor-like serine/threonine-protein kinase At5g63710 (Precursor)
trEMBL	tr\|A0A068U8K9\|A0A068U8K9_COFCA	4E-30	Coffea canephora DH200=94 genomic scaffold, scaffold_13 {ECO:0000313\|EMBL:CDP04632.1}
TAIR10	AT5G63710.1	3E-17	Leucine-rich repeat protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	83170243	83170834	+
GWHAAZE00000004	mRNA	83170243	83170834	+
GWHAAZE00000004	exon	83170243	83170394	+
GWHAAZE00000004	exon	83170511	83170582	+
GWHAAZE00000004	exon	83170765	83170834	+
GWHAAZE00000004	CDS	83170243	83170394	+
GWHAAZE00000004	CDS	83170511	83170582	+
GWHAAZE00000004	CDS	83170765	83170834	+

Transcript Sequence
>GWHTAAZE016824 ATGTATAGGGAATTGCAGGGCAATAATCTATGGGGTGAGTTACCGGATTATTTTGGAACCATGGTAAACCTGCAGAACCTGAATCTTGCACACAATAATTTTAACAGCTCTATACCAACCACTTGGGGTCAACTTTCTAACCTCAAACATCTGGTGTTAAGCGGAAACCACTTAACTGGATCTATTCCTGATTCACTTGCAAATATTACTGGCCTAACCAAACTGGATCTTTCATACAACGATCTAACTGGAAGGATCCCATCGCAATTGTTTTCAGTTCCCACGTTCAAGTAA

Network for GWHGAAZE016804

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0064

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13855.7	LRR_8	23	82	1.00E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.513
	SRR3591706	second leaf	8.777
	SRR3591707	mature leaf	33.000
	SRR3591708	Shoot apex	7.196
	SRR3591709	Stem	18.076
	SRR3591710	White floral bud	4.380
	SRR3591711	White flower	3.096
	SRR3591712	Green floral bud	3.714
	SRR3591713	Yellow flower	0.969
SRP173429	SRR8316895	Juvenile bud stage	3.171
	SRR8316896	Juvenile bud stage	2.591
	SRR8316897	Juvenile bud stage	1.809
	SRR8316894	Third green stage	2.092
	SRR8316900	Third green stage	4.284
	SRR8316901	Third green stage	2.722
	SRR8316898	Complete white stage	1.603
	SRR8316899	Complete white stage	9.463
	SRR8316903	Complete white stage	4.292
	SRR8316902	Silver flowering stage	1.774
	SRR8316904	Silver flowering stage	1.497
	SRR8316905	Silver flowering stage	1.084
	SRR8316906	Gold flowering stage	1.461
	SRR8316907	Gold flowering stage	1.632
	SRR8316908	Gold flowering stage	1.402
SRP132670	SRR6706286	Control	1.783
	SRR6706287	Light intensity 50%	2.387
	SRR6706288	Light intensity 20%	2.106
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.424
	CNS0095593	Slightly white alabastrum(diploid) 2	2.573
	CNS0095594	Slightly white alabastrum(diploid) 3	1.153
	CNS0095595	Whole white alabastrum(diploid) 2	2.594
	CNS0095596	Whole white alabastrum(diploid) 3	0.454
	CNS0095597	Whole white alabastrum(diploid) 4	3.223
	CNS0095598	Silvery flower (diploied) 1	12.933
	CNS0095599	Silvery flower (diploied) 2	9.784
	CNS0095600	Silvery flower (diploied) 3	7.719
	CNS0095601	Golden flower (diploid) 1	8.426
	CNS0095602	Golden flower (diploid) 2	2.670
	CNS0095603	Golden flower (diploid) 3	3.134
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.885
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.538
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.443
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.330
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.472
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.308
	CNS0095610	Silvery flower (tetraploid) 1	3.681
	CNS0095611	Silvery flower (tetraploid) 2	4.148
	CNS0095612	Silvery flower (tetraploid) 3	1.581
	CNS0095613	Golden flower (tetraploid) 1	0.964
	CNS0095614	Golden flower (tetraploid) 2	2.507
	CNS0095615	Golden flower (tetraploid) 3	0.220
CRA001975	CRR073297	Stem 1	0.970
	CRR073298	Stem 2	1.046
	CRR073299	Stem 3	1.514
	CRR073300	Leaf 1	1.163
	CRR073301	Leaf 2	1.250
	CRR073302	Leaf 3	1.622
	CRR073303	Juvenile bud 1	0.800
	CRR073304	Juvenile bud 2	0.260
	CRR073305	Juvenile bud 3	0.549
	CRR073306	Third green 1	0.390
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.172
	CRR073309	Second white 1	0.144
	CRR073310	Second white 2	0.083
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.690
	CRR073315	Gold flowering 1	4.739
	CRR073316	Gold flowering 2	11.015
	CRR073317	Gold flowering 3	3.238
	CRR073318	Tawny withering 1	8.268
	CRR073319	Tawny withering 2	17.123
	CRR073320	Tawny withering 3	9.092