Gene detail

Detail information of GWHGAAZE016897

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009772546.1	1.41778E-86	PREDICTED: B3 domain-containing protein At3g19184-like [Nicotiana sylvestris]
Swissprot	tr\|Q1G3M3\|Y3918_ARATH	8E-66	B3 domain-containing protein At3g19184
trEMBL	tr\|K4B330\|K4B330_SOLLC	1E-86	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g108140.2.1}
TAIR10	AT3G19184.1	6E-54	AP2/B3-like transcriptional factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	85222852	85233425	+
GWHAAZE00000004	mRNA	85222852	85233425	+
GWHAAZE00000004	exon	85222852	85222953	+
GWHAAZE00000004	exon	85229203	85229234	+
GWHAAZE00000004	exon	85229323	85229488	+
GWHAAZE00000004	exon	85230480	85230686	+
GWHAAZE00000004	exon	85233381	85233425	+
GWHAAZE00000004	CDS	85222852	85222953	+
GWHAAZE00000004	CDS	85229203	85229234	+
GWHAAZE00000004	CDS	85229323	85229488	+
GWHAAZE00000004	CDS	85230480	85230686	+
GWHAAZE00000004	CDS	85233381	85233425	+

Transcript Sequence
>GWHTAAZE016917 ATGAAGAAGGCGAAGCCCCGGGTACCTCGACAGCTGGTGGACCCATCTTTGGTCAGGAGATCCAGTCGGGTTGCGGACAAGCCACCCCCTAGTTACAAAGAAGTTCCAATTGAACCATTGGGAAGGCCTAGGAGTTATGGCCATAAACGGAGGGATATATCAAATCGAGTGTACGCCTCTGACGAGGACAGGGAATATGCGCACCATAGAGCAGAAGAGTTGCAATCAGATTTAGAATCTGACTACCCAAGCTTTGTTAAGCCAATGCTTCAATCTCATGTTACTGGTGGGTTTTGGCTGGGTCTTCCTCTTCAGTTCTGCAAGTCCCACCTTTCAAAATATGATGAAACAATCAGTTTAATCGATGAGGACCGCAATGAATGGTTCACCAAATACCTTGCTCGAAAATCTGGACTTAGCGGGGGTTGGAAAGGATTTGCTGTTGATCATGAATTAGTTGATGGGGATGCATTGGTTTTCCAATTAATCAAGCCTACAGCATTTAAGCTGCGTTGCGATAAAAATGAAGACCCGTCCTTTGTTGATGAATAA

Network for GWHGAAZE016897

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02362.22	B3	85	170	7.80E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	B3

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.504
	SRR3591706	second leaf	2.429
	SRR3591707	mature leaf	0.183
	SRR3591708	Shoot apex	29.253
	SRR3591709	Stem	5.005
	SRR3591710	White floral bud	0.238
	SRR3591711	White flower	0.797
	SRR3591712	Green floral bud	1.482
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.934
	SRR8316896	Juvenile bud stage	2.531
	SRR8316897	Juvenile bud stage	2.378
	SRR8316894	Third green stage	1.369
	SRR8316900	Third green stage	0.684
	SRR8316901	Third green stage	0.826
	SRR8316898	Complete white stage	0.379
	SRR8316899	Complete white stage	0.577
	SRR8316903	Complete white stage	0.004
	SRR8316902	Silver flowering stage	0.133
	SRR8316904	Silver flowering stage	0.147
	SRR8316905	Silver flowering stage	0.062
	SRR8316906	Gold flowering stage	0.476
	SRR8316907	Gold flowering stage	0.095
	SRR8316908	Gold flowering stage	0.518
SRP132670	SRR6706286	Control	1.034
	SRR6706287	Light intensity 50%	0.970
	SRR6706288	Light intensity 20%	1.362
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.961
	CNS0095593	Slightly white alabastrum(diploid) 2	2.064
	CNS0095594	Slightly white alabastrum(diploid) 3	2.571
	CNS0095595	Whole white alabastrum(diploid) 2	0.800
	CNS0095596	Whole white alabastrum(diploid) 3	0.459
	CNS0095597	Whole white alabastrum(diploid) 4	0.654
	CNS0095598	Silvery flower (diploied) 1	1.684
	CNS0095599	Silvery flower (diploied) 2	1.909
	CNS0095600	Silvery flower (diploied) 3	0.456
	CNS0095601	Golden flower (diploid) 1	0.570
	CNS0095602	Golden flower (diploid) 2	0.304
	CNS0095603	Golden flower (diploid) 3	0.472
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.609
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.122
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.131
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.496
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.081
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.202
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.281
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.076
	CNS0095614	Golden flower (tetraploid) 2	0.019
	CNS0095615	Golden flower (tetraploid) 3	0.090
CRA001975	CRR073297	Stem 1	4.922
	CRR073298	Stem 2	3.635
	CRR073299	Stem 3	8.925
	CRR073300	Leaf 1	1.614
	CRR073301	Leaf 2	0.977
	CRR073302	Leaf 3	0.274
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.271
	CRR073305	Juvenile bud 3	0.104
	CRR073306	Third green 1	0.046
	CRR073307	Third green 2	0.197
	CRR073308	Third green 3	0.234
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.025
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.040
	CRR073316	Gold flowering 2	1.513
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	8.276
	CRR073319	Tawny withering 2	4.118
	CRR073320	Tawny withering 3	8.148