Gene detail

Detail information of GWHGAAZE017122

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP03024.1	5.8847E-39	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q40134\|RAD51_SOLLC	8E-37	DNA repair protein RAD51 homolog
trEMBL	tr\|A0A068U4E1\|A0A068U4E1_COFCA	2E-39	Coffea canephora DH200=94 genomic scaffold, scaffold_9 {ECO:0000313\|EMBL:CDP03024.1}
TAIR10	AT5G20850.1	5E-26	RAS associated with diabetes protein 51

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	92166846	92168230	-
GWHAAZE00000004	mRNA	92166846	92168230	-
GWHAAZE00000004	exon	92168126	92168230	-
GWHAAZE00000004	exon	92166846	92167052	-
GWHAAZE00000004	CDS	92168126	92168230	-
GWHAAZE00000004	CDS	92166846	92167052	-

Transcript Sequence
>GWHTAAZE017142 ATGGCAATGGAGCAGCAGCGAAACCAGAAAACGACGGTGGTCCAAGAACAACAAGATGAACAAGAAGATGTGCAACATGGCCCTTTCCCTGTTGAACACCTTCAGGCGGCTGGGATTGCTGCTATTGATATAAAGAAGCTCAAAGATGCGGGTCTTTGTACAGTTGAATCTGTTGCATACTCTCCTAGGAAAGAACTTCTGCTAATCAAAGGAATTAGCGATGCAAAAGTTGACAAGATCGTCGAGGCAGGCATGTCATCCATCTATGTTCTGTTGTTGTTTTTGTTTGATTTCATACTTGAATTTGCATGA

Network for GWHGAAZE017122

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04482	RAD51	Homologous recombination	map03440
K04482	RAD51	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name
GO:0000166	molecular_function	nucleotide binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.856
	SRR3591706	second leaf	12.725
	SRR3591707	mature leaf	7.780
	SRR3591708	Shoot apex	20.641
	SRR3591709	Stem	6.929
	SRR3591710	White floral bud	7.562
	SRR3591711	White flower	8.985
	SRR3591712	Green floral bud	6.154
	SRR3591713	Yellow flower	7.982
SRP173429	SRR8316895	Juvenile bud stage	11.881
	SRR8316896	Juvenile bud stage	15.640
	SRR8316897	Juvenile bud stage	10.215
	SRR8316894	Third green stage	4.419
	SRR8316900	Third green stage	10.528
	SRR8316901	Third green stage	12.525
	SRR8316898	Complete white stage	3.545
	SRR8316899	Complete white stage	15.754
	SRR8316903	Complete white stage	7.097
	SRR8316902	Silver flowering stage	4.524
	SRR8316904	Silver flowering stage	7.745
	SRR8316905	Silver flowering stage	4.650
	SRR8316906	Gold flowering stage	10.292
	SRR8316907	Gold flowering stage	11.603
	SRR8316908	Gold flowering stage	10.884
SRP132670	SRR6706286	Control	16.333
	SRR6706287	Light intensity 50%	16.478
	SRR6706288	Light intensity 20%	20.273
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.712
	CNS0095593	Slightly white alabastrum(diploid) 2	9.364
	CNS0095594	Slightly white alabastrum(diploid) 3	7.517
	CNS0095595	Whole white alabastrum(diploid) 2	8.397
	CNS0095596	Whole white alabastrum(diploid) 3	5.308
	CNS0095597	Whole white alabastrum(diploid) 4	6.295
	CNS0095598	Silvery flower (diploied) 1	10.121
	CNS0095599	Silvery flower (diploied) 2	10.142
	CNS0095600	Silvery flower (diploied) 3	8.494
	CNS0095601	Golden flower (diploid) 1	10.600
	CNS0095602	Golden flower (diploid) 2	9.330
	CNS0095603	Golden flower (diploid) 3	8.282
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.499
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.322
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.924
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.514
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.033
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.956
	CNS0095610	Silvery flower (tetraploid) 1	10.054
	CNS0095611	Silvery flower (tetraploid) 2	10.128
	CNS0095612	Silvery flower (tetraploid) 3	8.855
	CNS0095613	Golden flower (tetraploid) 1	2.968
	CNS0095614	Golden flower (tetraploid) 2	7.301
	CNS0095615	Golden flower (tetraploid) 3	7.665
CRA001975	CRR073297	Stem 1	12.364
	CRR073298	Stem 2	13.691
	CRR073299	Stem 3	19.530
	CRR073300	Leaf 1	13.186
	CRR073301	Leaf 2	11.919
	CRR073302	Leaf 3	11.086
	CRR073303	Juvenile bud 1	9.440
	CRR073304	Juvenile bud 2	8.504
	CRR073305	Juvenile bud 3	9.524
	CRR073306	Third green 1	7.297
	CRR073307	Third green 2	6.048
	CRR073308	Third green 3	4.669
	CRR073309	Second white 1	6.147
	CRR073310	Second white 2	5.698
	CRR073311	Second white 3	3.548
	CRR073312	Silver flowering 1	3.249
	CRR073313	Silver flowering 2	3.498
	CRR073314	Silver flowering 3	1.802
	CRR073315	Gold flowering 1	13.110
	CRR073316	Gold flowering 2	18.013
	CRR073317	Gold flowering 3	12.880
	CRR073318	Tawny withering 1	13.328
	CRR073319	Tawny withering 2	21.888
	CRR073320	Tawny withering 3	15.762