Gene detail

Detail information of GWHGAAZE017278

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007024617.1	3.0106E-88	Myb domain protein 23 [Theobroma cacao]
Swissprot	tr\|Q9FJA2\|TT2_ARATH	2E-51	Transcription factor TT2
trEMBL	tr\|A0A061GJK0\|A0A061GJK0_THECC	1E-88	Myb domain protein 23 {ECO:0000313\|EMBL:EOY27239.1}
TAIR10	AT5G35550.1	1E-42	Duplicated homeodomain-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	3740952	3741819	+
GWHAAZE00000005	mRNA	3740952	3741819	+
GWHAAZE00000005	exon	3740952	3741117	+
GWHAAZE00000005	exon	3741257	3741386	+
GWHAAZE00000005	exon	3741477	3741819	+
GWHAAZE00000005	CDS	3740952	3741117	+
GWHAAZE00000005	CDS	3741257	3741386	+
GWHAAZE00000005	CDS	3741477	3741819	+

Transcript Sequence
>GWHTAAZE017298 ATGTGTTTTCGAAAGAGAGAGAGAGCAATGGCCTCTGTGAAAAATGAATCCATTATTAAGAAGGAAGTGAACAGGGGAGCATGGACAGATGAGGAAGATCAAAAATTGGCCCAAGCTATTGAAATCCATGGAGCCAAGAAGTGGAAAACAGTCGCCGCTAAAGCAGGTCTAAATAGATGTGGAAAGAGTTGTAGGCTAAGATGGATGAATTATTTAAGACCAAACATCAAAAGAGGGAATATATCAGATCAAGAGGAGGATTTGATCCTTAGGCTTCATAAGCTCCTAGGAAACAGATGGTCATTGATCGCAAGAAGATTACCGGGTCGAACGGATAATGAGATCAAGAATTATTGGAATTCTCATTTGAGAAAGAAGATGGACGACCAGAAGGAGAATATTCAAAGTGGAGCTTCAACAAGAGATGACTCCAAACCTAAAAAAAGAAGGGTAATAATAGAGAGGGAAAAGAGGGAGGTAAGAGAAGAGAGATCCAATGATACTGCTGCTGCAGAGGAGAATGCAAAGTTGAGCTTCAACGTTGATGATTTCTTTGATTTCTCCAACGAGGATCCATTGACTTTTGAATGGGTCAGTAGGTTCCAAGAAGTAGATGATTGTTTATGCGAGTTATCATGA

Network for GWHGAAZE017278

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	25	72	1.80E-18
PF00249.32	Myb_DNA-binding	78	123	3.70E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.927
	SRR3591706	second leaf	20.432
	SRR3591707	mature leaf	39.796
	SRR3591708	Shoot apex	8.381
	SRR3591709	Stem	3.714
	SRR3591710	White floral bud	1.825
	SRR3591711	White flower	1.926
	SRR3591712	Green floral bud	3.433
	SRR3591713	Yellow flower	0.300
SRP173429	SRR8316895	Juvenile bud stage	1.873
	SRR8316896	Juvenile bud stage	2.707
	SRR8316897	Juvenile bud stage	0.621
	SRR8316894	Third green stage	2.217
	SRR8316900	Third green stage	6.081
	SRR8316901	Third green stage	4.621
	SRR8316898	Complete white stage	0.315
	SRR8316899	Complete white stage	4.118
	SRR8316903	Complete white stage	0.450
	SRR8316902	Silver flowering stage	0.141
	SRR8316904	Silver flowering stage	0.094
	SRR8316905	Silver flowering stage	0.129
	SRR8316906	Gold flowering stage	0.952
	SRR8316907	Gold flowering stage	0.187
	SRR8316908	Gold flowering stage	1.506
SRP132670	SRR6706286	Control	4.939
	SRR6706287	Light intensity 50%	5.968
	SRR6706288	Light intensity 20%	6.332
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.454
	CNS0095593	Slightly white alabastrum(diploid) 2	7.712
	CNS0095594	Slightly white alabastrum(diploid) 3	3.550
	CNS0095595	Whole white alabastrum(diploid) 2	5.477
	CNS0095596	Whole white alabastrum(diploid) 3	6.380
	CNS0095597	Whole white alabastrum(diploid) 4	5.690
	CNS0095598	Silvery flower (diploied) 1	3.075
	CNS0095599	Silvery flower (diploied) 2	2.063
	CNS0095600	Silvery flower (diploied) 3	0.920
	CNS0095601	Golden flower (diploid) 1	0.844
	CNS0095602	Golden flower (diploid) 2	1.557
	CNS0095603	Golden flower (diploid) 3	1.237
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.128
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.105
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.923
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.954
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.763
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.981
	CNS0095610	Silvery flower (tetraploid) 1	2.589
	CNS0095611	Silvery flower (tetraploid) 2	1.287
	CNS0095612	Silvery flower (tetraploid) 3	0.312
	CNS0095613	Golden flower (tetraploid) 1	0.997
	CNS0095614	Golden flower (tetraploid) 2	3.305
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.104
	CRR073298	Stem 2	1.739
	CRR073299	Stem 3	0.846
	CRR073300	Leaf 1	2.466
	CRR073301	Leaf 2	1.702
	CRR073302	Leaf 3	1.221
	CRR073303	Juvenile bud 1	1.065
	CRR073304	Juvenile bud 2	0.594
	CRR073305	Juvenile bud 3	1.023
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.227
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.233
	CRR073315	Gold flowering 1	3.315
	CRR073316	Gold flowering 2	4.429
	CRR073317	Gold flowering 3	0.417
	CRR073318	Tawny withering 1	4.165
	CRR073319	Tawny withering 2	2.324
	CRR073320	Tawny withering 3	4.462