Gene detail

Detail information of GWHGAAZE017297

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO97884.1	7.861E-109	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LNQ1\|TI231_ARATH	1E-77	Mitochondrial import inner membrane translocase subunit TIM23-1
trEMBL	tr\|A0A068TPL5\|A0A068TPL5_COFCA	3E-109	Coffea canephora DH200=94 genomic scaffold, scaffold_2 {ECO:0000313\|EMBL:CDO97884.1}
TAIR10	AT1G17530.1	2E-55	translocase of inner mitochondrial membrane 23

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	4084448	4085017	+
GWHAAZE00000005	mRNA	4084448	4085017	+
GWHAAZE00000005	exon	4084448	4085017	+
GWHAAZE00000005	CDS	4084448	4085017	+

Transcript Sequence
>GWHTAAZE017317 ATGGCGTACCAACCTAGAGCTCCGAATCACAACGAAGACGACCACGACAACAATCGTCGACTATACAATCCCTACCAGGACCTCAAAGTCCCCATACAAACCCTATACAAGCTCCCAACCTCACCTGAATTCCTCTTCCAAGAAGAAGCCGTCGCTCAGCGCCGTTCCTGGGGTGAGAATCTCACCTACTACACCGGCATAGGTTACCTTGCCGGAGCCGTTTCCGGCGCTAGCAAAGGCATCTTCGAAGGCGTCAAGGCGTCGGAGCCGGGCGACACGACGAAGCTCAAGATCAACCGGATCCTGAACGCGTCCGGTCACTCCGGCCGACAGTTCGGGAATCGCGCCGGTGTCATTGGCTTGATGTACGCCGGGATAGAGAGTGGCATGGTGGCCGTGAGGGACACTGACGATATCGTGAACAGCGTGGTGGCCGGATTGGGAACCGGAGCGCTCTATAAGGCGGCGGCTGGGCCGAGGTCGGCTGCTGTGGCCGGAGCGATTGGTGGAGTGGTGGTTGGATTGGCGGTGACTGGGAAGCAGGTGTTGAAGAGATATGTGCCGATCTAG

Network for GWHGAAZE017297

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02466.20	Tim17	62	172	1.00E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17794	TIM23	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	39.168
	SRR3591706	second leaf	26.178
	SRR3591707	mature leaf	18.931
	SRR3591708	Shoot apex	32.230
	SRR3591709	Stem	38.982
	SRR3591710	White floral bud	48.424
	SRR3591711	White flower	56.857
	SRR3591712	Green floral bud	74.292
	SRR3591713	Yellow flower	52.958
SRP173429	SRR8316895	Juvenile bud stage	35.344
	SRR8316896	Juvenile bud stage	58.903
	SRR8316897	Juvenile bud stage	27.036
	SRR8316894	Third green stage	20.795
	SRR8316900	Third green stage	76.685
	SRR8316901	Third green stage	84.746
	SRR8316898	Complete white stage	22.637
	SRR8316899	Complete white stage	58.523
	SRR8316903	Complete white stage	24.662
	SRR8316902	Silver flowering stage	28.618
	SRR8316904	Silver flowering stage	25.750
	SRR8316905	Silver flowering stage	14.551
	SRR8316906	Gold flowering stage	42.301
	SRR8316907	Gold flowering stage	51.592
	SRR8316908	Gold flowering stage	55.176
SRP132670	SRR6706286	Control	59.023
	SRR6706287	Light intensity 50%	61.736
	SRR6706288	Light intensity 20%	62.675
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	81.434
	CNS0095593	Slightly white alabastrum(diploid) 2	87.351
	CNS0095594	Slightly white alabastrum(diploid) 3	89.002
	CNS0095595	Whole white alabastrum(diploid) 2	87.546
	CNS0095596	Whole white alabastrum(diploid) 3	93.867
	CNS0095597	Whole white alabastrum(diploid) 4	86.051
	CNS0095598	Silvery flower (diploied) 1	37.519
	CNS0095599	Silvery flower (diploied) 2	31.642
	CNS0095600	Silvery flower (diploied) 3	47.671
	CNS0095601	Golden flower (diploid) 1	35.459
	CNS0095602	Golden flower (diploid) 2	43.657
	CNS0095603	Golden flower (diploid) 3	37.218
	CNS0095604	Slightly white alabastrum(tetraploid) 1	90.999
	CNS0095605	Slightly white alabastrum(tetraploid) 2	97.056
	CNS0095606	Slightly white alabastrum(tetraploid) 3	55.057
	CNS0095607	Whole white alabastrum(tetraploid) 1	94.107
	CNS0095608	Whole white alabastrum(tetraploid) 2	68.688
	CNS0095609	Whole white alabastrum(tetraploid) 3	64.178
	CNS0095610	Silvery flower (tetraploid) 1	47.599
	CNS0095611	Silvery flower (tetraploid) 2	47.107
	CNS0095612	Silvery flower (tetraploid) 3	51.695
	CNS0095613	Golden flower (tetraploid) 1	37.061
	CNS0095614	Golden flower (tetraploid) 2	49.262
	CNS0095615	Golden flower (tetraploid) 3	33.975
CRA001975	CRR073297	Stem 1	57.019
	CRR073298	Stem 2	63.676
	CRR073299	Stem 3	78.077
	CRR073300	Leaf 1	72.899
	CRR073301	Leaf 2	72.870
	CRR073302	Leaf 3	94.153
	CRR073303	Juvenile bud 1	89.786
	CRR073304	Juvenile bud 2	83.946
	CRR073305	Juvenile bud 3	65.799
	CRR073306	Third green 1	71.632
	CRR073307	Third green 2	95.109
	CRR073308	Third green 3	74.114
	CRR073309	Second white 1	91.968
	CRR073310	Second white 2	59.292
	CRR073311	Second white 3	42.622
	CRR073312	Silver flowering 1	63.655
	CRR073313	Silver flowering 2	101.737
	CRR073314	Silver flowering 3	67.123
	CRR073315	Gold flowering 1	47.310
	CRR073316	Gold flowering 2	47.695
	CRR073317	Gold flowering 3	47.628
	CRR073318	Tawny withering 1	81.239
	CRR073319	Tawny withering 2	90.449
	CRR073320	Tawny withering 3	86.193