Gene detail

Detail information of GWHGAAZE017359

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282496.1	1.71175E-48	PREDICTED: mediator of RNA polymerase II transcription subunit 6 [Vitis vinifera]
Swissprot	tr\|F4IXJ7\|MED6_ARATH	4E-34	Mediator of RNA polymerase II transcription subunit 6
trEMBL	tr\|F6HY64\|F6HY64_VITVI	6E-49	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB59387.1}
TAIR10	AT3G21350.1	7E-25	RNA polymerase transcriptional regulation mediator-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	5076070	5076336	+
GWHAAZE00000005	mRNA	5076070	5076336	+
GWHAAZE00000005	exon	5076070	5076336	+
GWHAAZE00000005	CDS	5076070	5076336	+

Transcript Sequence
>GWHTAAZE017379 ATGGCGTCGACGCCAATGTTGCCGCCTAATTCAGTGACCGGAAACCCTAACTTCGATGGGAATCCGGTGGCAGGGGCTCCACCGCCGCCGGGAACGGACATGACCGGAATATGCTTCAGGGATCAGCTGTGGTTGAACACGTACCCGCTGGACCGGAACCTGGTTTTCGACTACTTCGCTCTTTCTCCTTTCTACGATTGGACCTGCAACAACGAACAAATCAGGATGCGTTCTATTCATCCTCTCGATATTTCTCATCTCTCGTAA

Network for GWHGAAZE017359

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04934.15	Med6	37	81	1.10E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MED6

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006357	biological_process	regulation of transcription by RNA polymerase II
GO:0016592	cellular_component	mediator complex
GO:0003712	molecular_function	transcription coregulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.817
	SRR3591706	second leaf	31.796
	SRR3591707	mature leaf	44.914
	SRR3591708	Shoot apex	72.131
	SRR3591709	Stem	70.393
	SRR3591710	White floral bud	53.408
	SRR3591711	White flower	59.312
	SRR3591712	Green floral bud	48.355
	SRR3591713	Yellow flower	58.208
SRP173429	SRR8316895	Juvenile bud stage	47.108
	SRR8316896	Juvenile bud stage	47.749
	SRR8316897	Juvenile bud stage	20.831
	SRR8316894	Third green stage	16.020
	SRR8316900	Third green stage	49.427
	SRR8316901	Third green stage	49.981
	SRR8316898	Complete white stage	21.262
	SRR8316899	Complete white stage	77.664
	SRR8316903	Complete white stage	37.181
	SRR8316902	Silver flowering stage	20.296
	SRR8316904	Silver flowering stage	29.360
	SRR8316905	Silver flowering stage	10.955
	SRR8316906	Gold flowering stage	50.102
	SRR8316907	Gold flowering stage	44.388
	SRR8316908	Gold flowering stage	46.544
SRP132670	SRR6706286	Control	89.086
	SRR6706287	Light intensity 50%	79.248
	SRR6706288	Light intensity 20%	81.923
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	45.082
	CNS0095593	Slightly white alabastrum(diploid) 2	40.168
	CNS0095594	Slightly white alabastrum(diploid) 3	34.948
	CNS0095595	Whole white alabastrum(diploid) 2	43.230
	CNS0095596	Whole white alabastrum(diploid) 3	33.602
	CNS0095597	Whole white alabastrum(diploid) 4	28.933
	CNS0095598	Silvery flower (diploied) 1	61.213
	CNS0095599	Silvery flower (diploied) 2	47.685
	CNS0095600	Silvery flower (diploied) 3	57.571
	CNS0095601	Golden flower (diploid) 1	51.452
	CNS0095602	Golden flower (diploid) 2	59.368
	CNS0095603	Golden flower (diploid) 3	58.660
	CNS0095604	Slightly white alabastrum(tetraploid) 1	60.087
	CNS0095605	Slightly white alabastrum(tetraploid) 2	51.493
	CNS0095606	Slightly white alabastrum(tetraploid) 3	99.260
	CNS0095607	Whole white alabastrum(tetraploid) 1	40.949
	CNS0095608	Whole white alabastrum(tetraploid) 2	35.583
	CNS0095609	Whole white alabastrum(tetraploid) 3	59.672
	CNS0095610	Silvery flower (tetraploid) 1	72.399
	CNS0095611	Silvery flower (tetraploid) 2	78.488
	CNS0095612	Silvery flower (tetraploid) 3	56.643
	CNS0095613	Golden flower (tetraploid) 1	49.569
	CNS0095614	Golden flower (tetraploid) 2	70.975
	CNS0095615	Golden flower (tetraploid) 3	49.898
CRA001975	CRR073297	Stem 1	55.946
	CRR073298	Stem 2	49.437
	CRR073299	Stem 3	62.866
	CRR073300	Leaf 1	45.107
	CRR073301	Leaf 2	53.457
	CRR073302	Leaf 3	50.445
	CRR073303	Juvenile bud 1	40.479
	CRR073304	Juvenile bud 2	33.261
	CRR073305	Juvenile bud 3	45.570
	CRR073306	Third green 1	14.164
	CRR073307	Third green 2	11.732
	CRR073308	Third green 3	15.494
	CRR073309	Second white 1	18.952
	CRR073310	Second white 2	22.259
	CRR073311	Second white 3	13.341
	CRR073312	Silver flowering 1	10.667
	CRR073313	Silver flowering 2	17.775
	CRR073314	Silver flowering 3	15.044
	CRR073315	Gold flowering 1	15.727
	CRR073316	Gold flowering 2	24.931
	CRR073317	Gold flowering 3	25.246
	CRR073318	Tawny withering 1	34.504
	CRR073319	Tawny withering 2	46.007
	CRR073320	Tawny withering 3	45.210